FLI1 (NM_001167681) Human Untagged Clone
CAT#: SC328686
FLI1 (untagged)-Human Friend leukemia virus integration 1 (FLI1) transcript variant 2
"NM_001167681" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FLI1 |
Synonyms | BDPLT21; EWSR2; SIC-1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001167681, the custom clone sequence may differ by one or more nucleotides
ATGACTGCCTCGGGGAGTCCTGACTACGGGCAGCCCCACAAGATCAACCCCCTCCCACCA CAGCAGGAGTGGATCAATCAGCCAGTGAGGGTCAACGTCAAGCGGGAGTATGACCACATG AATGGATCCAGGGAGTCTCCGGTGGACTGCAGCGTTAGCAAATGCAGCAAGCTGGTGGGC GGAGGCGAGTCCAACCCCATGAACTACAACAGCTATATGGACGAGAAGAATGGCCCCCCT CCTCCCAACATGACCACCAACGAGAGGAGAGTCATCGTCCCCGCAGACCCCACACTGTGG ACACAGGAGCATGTGAGGCAATGGCTGGAGTGGGCCATAAAGGAGTACAGCTTGATGGAG ATCGACACATCCTTTTTCCAGAACATGGATGGCAAGGAACTGTGTAAAATGAACAAGGAG GACTTCCTCCGCGCCACCACCCTCTACAACACGGAAGTGCTGTTGTCACACCTCAGTTAC CTCAGGGAAAGTTCACTGCTGGCCTATAATACAACCTCCCACACCGACCAATCCTCACGA TTGAGTGTCAAAGAAGACCCTTCTTATGACTCAGTCAGAAGAGGAGCTTGGGGCAATAAC ATGAATTCTGGCCTCAACAAAAGTCCTCCCCTTGGAGGGGCACAAACGATCAGTAAGAAT ACAGAGCAACGGCCCCAGCCAGATCCGTATCAGATCCTGGGCCCGACCAGCAGTCGCCTA GCCAACCCTGGAAGCGGGCAGATCCAGCTGTGGCAATTCCTCCTGGAGCTGCTCTCCGAC AGCGCCAACGCCAGCTGTATCACCTGGGAGGGGACCAACGGGGAGTTCAAAATGACGGAC CCCGATGAGGTGGCCAGGCGCTGGGGCGAGCGGAAAAGCAAGCCCAACATGAATTACGAC AAGCTGAGCCGGGCCCTCCGTTATTACTATGATAAAAACATTATGACCAAAGTGCACGGC AAAAGATATGCTTACAAATTTGACTTCCACGGCATTGCCCAGGCTCTGCAGCCACATCCG ACCGAGTCGTCCATGTACAAGTACCCTTCTGACATCTCCTACATGCCTTCCTACCATGCC CACCAGCAGAAGGTGAACTTTGTCCCTCCCCATCCATCCTCCATGCCTGTCACTTCCTCC AGCTTCTTTGGAGCCGCATCACAATACTGGACCTCCCCCACGGGGGGAATCTACCCCAAC CCCAACGTCCCCCGCCATCCTAACACCCACGTGCCTTCACACTTAGGCAGCTACTACTAG |
Restriction Sites | Please inquire |
ACCN | NM_001167681 |
Insert Size | 4049 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001167681.1, NP_001161153.1 |
RefSeq Size | 4049 bp |
RefSeq ORF | 1260 bp |
Locus ID | 2313 |
Cytogenetics | 11q24.3 |
Protein Families | Transcription Factors |
Gene Summary | 'This gene encodes a transcription factor containing an ETS DNA-binding domain. The gene can undergo a t(11;22)(q24;q12) translocation with the Ewing sarcoma gene on chromosome 22, which results in a fusion gene that is present in the majority of Ewing sarcoma cases. An acute lymphoblastic leukemia-associated t(4;11)(q21;q23) translocation involving this gene has also been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]' Transcript Variant: This variant (2) contains a distinct 5' UTR and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230048 | FLI1 (Myc-DDK-tagged)-Human Friend leukemia virus integration 1 (FLI1), transcript variant 2 |
USD 420.00 |
|
RG230048 | FLI1 (GFP-tagged) - Human Friend leukemia virus integration 1 (FLI1), transcript variant 2 |
USD 460.00 |
|
RC230048L3 | Lenti-ORF clone of FLI1 (Myc-DDK-tagged)-Human Friend leukemia virus integration 1 (FLI1), transcript variant 2 |
USD 620.00 |
|
RC230048L4 | Lenti-ORF clone of FLI1 (mGFP-tagged)-Human Friend leukemia virus integration 1 (FLI1), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review