ZFX (NM_001178095) Human Untagged Clone

CAT#: SC328710

ZFX (untagged)-Human zinc finger protein X-linked (ZFX) transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZFX
• Synonyms: ZNF926
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001178095, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATGAAGATGGGCTTGAATTACAACAAGAGCCAAACTCATTTTTTGATGCAACAGGAGCTGATGGTA
  CACACATGGATGGTGATCAAATTGTTGTGGAAGTACAAGAAACTGTTTTTGTTTCAGATGTTGTGGATTC
  AGACATAACTGTGCATAACTTTGTTCCTGATGACCCAGATTCAGTTGTAATCCAAGATGTTATTGAGGAC
  GTTGTTATAGAAGATGTTCAGTGCCCAGATATCATGGAAGAAGCAGATGTGTCTGAAACGGTCATCATTC
  CTGAGCAAGTGCTGGACTCAGATGTAACTGAAGAAGTTTCTTTAGCACATTGCACAGTCCCAGATGATGT
  TTTAGCTTCTGACATTACTTCAGCCTCAATGTCTATGCCAGAACACGTCTTGACGGGTGATTCTATACAT
  GTGTCTGACGTTGGACATGTTGGACATGTTGGACATGTTGAACATGTGGTTCATGATAGTGTAGTGGAAG
  CAGAAATTGTCACTGATCCTCTGACTACCGACGTAGTTTCAGAAGAAGTATTGGTAGCAGACTGTGCCTC
  TGAAGCAGTCATAGATGCCAATGGGATCCCTGTGGACCAGCAGGATGATGACAAAGGCAACTGTGAGGAC
  TACCTTATGATTTCCTTGGATGATGCTGGCAAAATAGAACACGATGGTTCTTCTGGAATGACCATGGACA
  CAGAGTCGGAAATTGATCCTTGTAAAGTGGATGGCACTTGCCCTGAGGTCATCAAGGTGTACATTTTTAA
  AGCTGACCCTGGAGAAGATGACTTAGGTGGAACTGTAGACATTGTGGAGAGTGAGCCTGAGAATGATCAT
  GGAGTTGAACTGCTTGATCAGAACAGCAGTATTCGTGTTCCCAGGGAAAAGATGGTTTATATGACTGTCA
  ATGACTCTCAGCCAGAAGATGAAGATTTAAATGTTGCTGAAATCGCTGACGAAGTTTATATGGAAGTGAT
  CGTAGGAGAGGAGGATGCTGCAGCAGCAGCGGCAGCCGCCGCCGTGCACGAGCAGCAAATGGATGACAAT
  GAAATCAAAACCTTCATGCCGATTGCATGGGCAGCAGCTTATGGTAATAATTCTGATGGAATTGAAAACC
  GGAATGGCACTGCAAGTGCCCTCTTGCACATAGATGAGTCTGCTGGCCTCGGCAGACTGGCTAAACAAAA
  ACCAAAGAAAAGGAGAAGACCTGATTCCAGGCAGTACCAAACAGGTGAGGGCGCACGAGTTCCATGGCGC
  AGCGTGCTCTGCGAGCTCTCAGAGGAAACTCTACAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001178095
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001178095.1, NP_001171566.1
• RefSeq Size: 7534 bp
• RefSeq ORF: 1299 bp
• Locus ID: 7543
• Cytogenetics: Xp22.11
• Protein Families: Transcription Factors
• Gene Summary: 'This gene on the X chromosome is structurally similar to a related gene on the Y chromosome. It encodes a member of the krueppel C2H2-type zinc-finger protein family. The full-length protein contains an acidic transcriptional activation domain (AD), a nuclear localization sequence (NLS) and a DNA binding domain (DBD) consisting of 13 C2H2-type zinc fingers. Studies in mouse embryonic and adult hematopoietic stem cells showed that this gene was required as a transcriptional regulator for self-renewal of both stem cell types, but it was dispensable for growth and differentiation of their progeny. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, but the full-length nature of some variants has not been determined. [provided by RefSeq, May 2010]'
  Transcript Variant: This variant (5) lacks two exons in the 5' UTR and has an additional segment in the 3' CDS, as compared to variant 1. The resulting isoform (3) is shorter and has a distinct C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.