AF10 (MLLT10) (NM_001195630) Human Untagged Clone

CAT#: SC329458

MLLT10 (untagged) - Homo sapiens myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 10 (MLLT10), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MLLT10
• Synonyms: AF10
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001195630, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTCTCTAGCGACCGGCCCGTGTCACTGGAGGACGAGGTCTCCCATAGTATGAAGGAGATGATTGGAG
  GCTGTTGCGTTTGCTCAGACGAGAGAGGCTGGGCCGAGAACCCGCTGGTTTATTGCGACGGGCACGGCTG
  CAGCGTCGCGGTGCATCAAGCTTGCTATGGCATTGTTCAAGTACCCACTGGACCGTGGTTTTGCAGGAAA
  TGTGAATCTCAGGAGAGAGCAGCCAGAGTGATGGTATGCAATTCCTGTTGGTTAGCCTCATCTGAAAACG
  TCACTCCTGGATACATAGAACATCACTGCGCATGTGCATCTCCCCACCCCCGATGCCTGGTGTCTAACGT
  TCCTCCAGTTTCTGGTGCTCTGATGCATTGCTTTTGGGCTTGTCTTACTACAGCAGCTTTCTTCGGTCCT
  CAGTCATTTACCACTTGTCATATGTCCTTTCTAGTTTCCAGGGATATTCTTTTTTATATTTATGGCTTTA
  TGCCATTTATCTCAGTTGTCATTTGGCGTTTCAAGAAGGAGAGGTGGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001195630
• ORF Size: 540 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001195630.1, NP_001182559.1
• RefSeq Size: 1148
• RefSeq ORF: 540
• Locus ID: 8028
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: This gene encodes a transcription factor and has been identified as a partner gene involved in several chromosomal rearrangements resulting in various leukemias. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
  Transcript Variant: This variant (5) has multiple differences in the coding region, compared to variant 1, one of which results in a translational frameshift and early stop codon. The resulting protein (isoform e) has a distinct C-terminus and is shorter than isoform a. Variants 5, 6, and 7 all encode the same isoform (e).