GABPA (NM_001197297) Human Untagged Clone
CAT#: SC329464
GABPA (untagged) - Homo sapiens GA binding protein transcription factor, alpha subunit 60kDa (GABPA), transcript variant 2
"NM_001197297" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GABPA |
Synonyms | E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A; RCH04A07 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001197297, the custom clone sequence may differ by one or more nucleotides
ATGACTAAAAGAGAAGCAGAGGAGCTGATAGAAATTGAGATTGATGGAACAGAGAAAGCAGAGTGCACAG AAGAAAGCATTGTAGAACAAACCTACGCGCCAGCTGAATGTGTAAGCCAGGCCATAGACATCAATGAACC AATAGGCAATTTAAAGAAACTGCTAGAACCAAGACTACAGTGTTCTTTGGATGCTCATGAAATTTGTCTG CAAGATATCCAGCTGGATCCAGAACGAAGTTTATTTGACCAAGGAGTAAAAACAGATGGAACTGTACAGC TTAGTGTACAGGTAATTTCTTACCAAGGAATTGAACCAAAGTTAAACATCCTTGAAATTGTTAAACCTGC GGACACTGTTGAGGTTGTTATTGATCCAGATGCCCACCATGCTGAATCAGAAGCACATCTTGTTGAAGAA GCTCAAGTGATAACTCTTGATGGCACAAAACACATCACAACCATTTCAGATGAAACTTCAGAACAAGTGA CAAGATGGGCTGCTGCACTGGAAGGCTATAGGAAAGAACAAGAACGCCTTGGGATACCCTATGATCCCAT ACAGTGGTCCACAGACCAAGTCCTGCATTGGGTGGTTTGGGTAATGAAGGAATTCAGCATGACCGATATA GACCTCACCACACTCAACATTTCGGGGAGAGAATTATGTAGTCTCAACCAAGAAGATTTTTTTCAGCGGG TTCCTCGGGGAGAAATTCTCTGGAGTCATCTGGAACTTCTCCGAAAATATGTATTGGCAAGTCAAGAACA ACAGATGAATGAAATAGTTACAATTGATCAACCTGTGCAAATTATTCCAGCATCAGTGCAATCTGCTACA CCTACTACCATTAAAGTTATAAATAGTAGTGCGAAAGCAGCCAAAGTACAAAGAGCGCCGAGGATTTCAG GAGAAGATAGAAGCTCACCTGGGAACAGAACAGGAAACAATGGCCAAATCCAACTATGGCAGTTTTTGCT AGAACTTCTTACTGATAAGGACGCTCGAGACTGCATTTCTTGGGTTGGTGATGAAGGTGAATTTAAGCTA AATCAGCCTGAACTGGTTGCACAGAAATGGGGACAGCGTAAAAATAAGCCTACGATGAACTATGAGAAAC TCAGTCGTGCATTAAGATATTATTACGATGGGGACATGATTTGTAAAGTTCAAGGCAAGAGATTTGTGTA CAAGTTTGTCTGTGACTTGAAGACTCTTATTGGATACAGTGCAGCGGAGTTGAACCGTTTGGTCACAGAA TGTGAACAGAAGAAACTTGCAAAGATGCAGCTCCATGGAATTGCCCAGCCAGTCACAGCAGTAGCTCTGG CTACTGCTTCTCTGCAAACGGAAAAGGATAATTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001197297 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001197297.1, NP_001184226.1 |
RefSeq Size | 4745 bp |
RefSeq ORF | 1365 bp |
Locus ID | 2551 |
Cytogenetics | 21q21.3 |
Protein Families | Transcription Factors |
Gene Summary | 'This gene encodes one of three GA-binding protein transcription factor subunits which functions as a DNA-binding subunit. Since this subunit shares identity with a subunit encoding the nuclear respiratory factor 2 gene, it is likely involved in activation of cytochrome oxidase expression and nuclear control of mitochondrial function. This subunit also shares identity with a subunit constituting the transcription factor E4TF1, responsible for expression of the adenovirus E4 gene. Because of its chromosomal localization and ability to form heterodimers with other polypeptides, this gene may play a role in the Down Syndrome phenotype. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2010]' Transcript Variant: This variant differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232773 | GABPA (Myc-DDK tagged) - Homo sapiens GA binding protein transcription factor, alpha subunit 60kDa (GABPA), transcript variant 2 |
USD 420.00 |
|
RG232773 | GABPA (GFP-tagged) - Homo sapiens GA binding protein transcription factor, alpha subunit 60kDa (GABPA), transcript variant 2 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review