CIDE C (CIDEC) (NM_001199551) Human Untagged Clone
CAT#: SC329532
CIDEC (untagged) - Homo sapiens cell death-inducing DFFA-like effector c (CIDEC), transcript variant 2
"NM_001199551" in other vectors (2)
Product Images
Other products for "CIDEC"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CIDEC |
Synonyms | CIDE-3; CIDE3; FPLD5; FSP27 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001199551, the custom clone sequence may differ by one or more nucleotides
ATGGAATACGCCATGAAGTCCCTTAGCCTTCTCTACCCCAAGTCCCTCTCCAGGCATGTGTCAGTGCGTA CCTCTGTGGTGACCCAGCAGCTGCTGTCGGAGCCCAGCCCCAAGGCCCCCAGGGCCCGGCCCTGCCGCGT AAGCACGGCGGATCGAAGCGTGAGGAAGGGCATCATGGCTTACAGTCTTGAGGACCTCCTCCTCAAGACT AGGAACCCTGAAGCCAGGAGCCAAGAGGTCCGGGACACTCTGATGCTGGCAGACAAGCCCTTCTTCCTGG TGCTGGAGGAAGATGGCACAACTGTAGAGACAGAAGAGTACTTCCAAGCCCTGGCAGGGGATACAGTGTT CATGGTCCTCCAGAAGGGGCAGAAATGGCAGCCCCCATCAGAACAGGGGACAAGGCACCCACTGTCCCTC TCCCATAAGCCTGCCAAGAAGATTGATGTGGCCCGTGTAACGTTTGATCTGTACAAGCTGAACCCACAGG ACTTCATTGGCTGCCTGAACGTGAAGGCGACTTTTTATGATACATACTCCCTTTCCTATGATCTGCACTG CTGTGGGGCCAAGCGCATCATGAAGGAAGCTTTCCGCTGGGCCCTCTTCAGCATGCAGGCCACAGGCCAC GTACTGCTTGGCACCTCCTGTTACCTGCAGCAGCTCCTCGATGCTACGGAGGAAGGGCAGCCCCCCAAGG GCAAGGCCTCATCCCTTATCCCGACCTGTCTGAAGATACTGCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199551 |
ORF Size | 747 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001199551.1, NP_001186480.1 |
RefSeq Size | 1244 |
RefSeq ORF | 747 |
Locus ID | 63924 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the cell death-inducing DNA fragmentation factor-like effector family. Members of this family play important roles in apoptosis. The encoded protein promotes lipid droplet formation in adipocytes and may mediate adipocyte apoptosis. This gene is regulated by insulin and its expression is positively correlated with insulin sensitivity. Mutations in this gene may contribute to insulin resistant diabetes. A pseudogene of this gene is located on the short arm of chromosome 3. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (2) differs in the 5' UTR, lacks an in-frame portion of the 5' coding region, and contains an alternate coding exon, compared to variant 1. This variant encodes isoform 2, which is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.