DCTN5 (NM_001199743) Human Untagged Clone

CAT#: SC329554

DCTN5 (untagged) - Homo sapiens dynactin 5 (p25) (DCTN5), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DCTN5
• Synonyms: MGC3248
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199743, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGTTGGGCGAGCTGCTCTACAACAAGTCTGAGTACATCGAGACGGCATCTGGGAACAAAGTCAGTC
  GCCAGTCAGTGTTGTGTGGAAGCCAGAACATCGTTCTCAATGGCAAGACCATTGTGATGAATGACTGTAT
  TATCCGAGGGGATCTGGCAAATGTAAGAGTTGGACGTCATTGTGTTGTGAAAAGTCGTAGTGTCATAAGG
  CCACCATTCAAGAAGTTCAGCAAAGGTGTTGCATTCTTTCCTTTACATATTGGAGACCATGTCTTTATTG
  AGGAAGATTGTGTGGTCAACGCAGCACAGATTGGTTCCTATGTTCATGTTGGGAAGAACTGTGTGATTGG
  GCGCCGATGTGTGTTGAAAGACTGCTGCAAAATTCTTGACAACACAGTATTACCTCCAGAAACTGTGGTT
  CCACCATTCACTGTCTTCTCAGGCTGCCCAGCTCCTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199743
• ORF Size: 459 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001199743.1, NP_001186672.1
• RefSeq Size: 7359
• RefSeq ORF: 459
• Locus ID: 84516
• Gene Summary: This gene encodes a subunit of dynactin, a component of the cytoplasmic dynein motor machinery involved in minus-end-directed transport. The encoded protein is a component of the pointed-end subcomplex and is thought to bind membranous cargo. A pseudogene of this gene is located on the long arm of chromosome 1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
  Transcript Variant: This variant (4) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 3, which has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.