GGCT (NM_001199816) Human Untagged Clone

CAT#: SC329570

GGCT (untagged) - Homo sapiens gamma-glutamylcyclotransferase (GGCT), transcript variant 3


  "NM_001199816" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GGCT"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GGCT
Synonyms C7orf24; CRF21; GCTG; GGC
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001199816, the custom clone sequence may differ by one or more nucleotides


ATGGCCAACTCGGGCTGCAAGGACGTCACGGGTCCAGATGAGGAGAGTTTTCTGTACTTTGCCTACGGCA
GCAACCTGCTGACAGAGAGGATCCACCTCCGAAACCCCTCGGCGGCGTTCTTCTGTGTGGCCCGCCTGCA
GGATTTTAAGCTTGACTTTGGCAATTCCCAAGGCAAAACAAGTCAAACTTGGCATGGAGGGATAGCCACC
ATTTTTCAGAGTCCTGGCGATGAAGTGTGGGGAGTAGTATGGAAAATGAACAAAAGCAATTTAAATTCTC
TGGATGAATTATTTGCATGGGTGCAAAAGAAAATGGTTTGCCGCTGGAGTATCAAGAGAAGTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001199816
ORF Size 345 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001199816.1, NP_001186745.1
RefSeq Size 1061
RefSeq ORF 345
Locus ID 79017
Protein Pathways Glutathione metabolism
Gene Summary The protein encoded by this gene catalyzes the formation of 5-oxoproline from gamma-glutamyl dipeptides, the penultimate step in glutathione catabolism, and may play a critical role in glutathione homeostasis. The encoded protein may also play a role in cell proliferation, and the expression of this gene is a potential marker for cancer. Pseudogenes of this gene are located on the long arm of chromosome 5 and the short arm of chromosomes 2 and 20. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (3) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.