NDUFB5 (NM_001199958) Human Untagged Clone

CAT#: SC329602

NDUFB5 (untagged) - Homo sapiens NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa (NDUFB5), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NDUFB5
• Synonyms: CISGDH; SGDH
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199958, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCCATGAGTTTGTTGCGGCGGGTTTCGGTTACTGCGGTGGCAGCTCTGTCTGGCCGGCCCCTTG
  GCACTCGCCTCGGATTTGGGGGCTTCCTCACTCGTGGCTTTCCGAAGGCTGCTGCTCCTGTTCGACACAG
  TGGAGACCATGGGAAAAGACTATTTGTCATCAGACCTTCTAGATTCTATGACAGGCGTTTTTTGAAGTTA
  TTGAGATTCTACATTGCATTGACTGGGATTCCAGTAGCAATTTTCATAACTCTGGTGAATGTATTCATTG
  GTCAAGCTGAACTAGCAGAAATTCCAGAAGGCTATGTCCCAGAACACTGGGAATATTATAAGGGTAAAGG
  AGCTGGAAGTGCGAAAATTGATGCATGTGAGAGGAGATGGACCCTGGTATTACTATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199958
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199958.1, NP_001186887.1
• RefSeq Size: 969 bp
• RefSeq ORF: 408 bp
• Locus ID: 4711
• Cytogenetics: 3q26.33
• Protein Families: Transmembrane
• Protein Pathways: Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
• Gene Summary: 'The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]'
  Transcript Variant: This variant (3) lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1.