HYAL3 (NM_001200031) Human Untagged Clone

CAT#: SC329611

HYAL3 (untagged) - Homo sapiens hyaluronoglucosaminidase 3 (HYAL3), transcript variant 3


  "NM_001200031" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HYAL3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HYAL3
Synonyms HYAL-3; LUCA-3; LUCA3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001200031, the custom clone sequence may differ by one or more nucleotides


ATGCTGCCACCTGCCCACCACCAGGCCTTTGTCCGACATCGCCTGGAGGAGGCCTTCCGTGTGGCCCTTG
TTGGGCACCGACATCCCCTGCCTGTCCTGGCCTATGTCCGCCTCACACACCGGAGATCTGGGAGGTTCCT
GTCCCAGGATGACCTTGTGCAGTCCATTGGTGTGAGTGCAGCACTAGGGGCAGCCGGCGTGGTGCTCTGG
GGGGACCTGAGCCTCTCCAGCTCTGAGGAGGAGTGCTGGCATCTCCATGACTACCTGGTGGACACCTTGG
GCCCCTATGTGATCAATGTGACCAGGGCAGCGATGGCCTGCAGTCACCAGCGGTGCCATGGCCACGGGCG
CTGTGCCCGGCGAGATCCAGGACAGATGGAAGCCTTTCTACACCTGTGGCCAGACGGCAGCCTTGGAGAT
TGGAAGTCCTTCAGCTGCCACTGTTACTGGGGCTGGGCTGGCCCCACCTGCCAGGAGCCCAGGCCTGGGC
CTAAAGAAGCAGTATAA


Restriction Sites SgfI-MluI     
ACCN NM_001200031
ORF Size 507 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001200031.1, NP_001186960.1
RefSeq Size 1179
RefSeq ORF 507
Locus ID 8372
Protein Families Secreted Protein
Protein Pathways Glycosaminoglycan degradation, Metabolic pathways
Gene Summary This gene encodes a member of the hyaluronidase family. Hyaluronidases are endoglycosidase enzymes that degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. The regulated turnover of hyaluronan plays a critical role in many biological processes including cell proliferation, migration and differentiation. The encoded protein may also play an important role in sperm function. This gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression, and the expression of specific transcript variants may be indicative of tumor status. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and some isoforms may lack hyaluronidase activity. This gene overlaps and is on the same strand as N-acetyltransferase 6 (GCN5-related), and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (3), also known as HYAL3-v2, initiates translation at an upstream start codon and uses an alternate in-frame splice site in the coding region, compared to variant 1. The encoded isoform (3) is shorter and has a distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.