HYAL3 (NM_001200032) Human Untagged Clone
CAT#: SC329612
HYAL3 (untagged) - Homo sapiens hyaluronoglucosaminidase 3 (HYAL3), transcript variant 4
"NM_001200032" in other vectors (2)
Product Images
Other products for "HYAL3"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HYAL3 |
Synonyms | HYAL-3; LUCA-3; LUCA3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001200032, the custom clone sequence may differ by one or more nucleotides
ATGCTGCCACCTGCCCACCACCAGGCCTTTGTCCGACATCGCCTGGAGGAGGCCTTCCGTGTGGCCCTTG TTGGGCACCGACATCCCCTGCCTGTCCTGGCCTATGTCCGCCTCACACACCGGAGATCTGGGAGGTTCCT GTCCCAGGAGGAGTGCTGGCATCTCCATGACTACCTGGTGGACACCTTGGGCCCCTATGTGATCAATGTG ACCAGGGCAGCGATGGCCTGCAGTCACCAGCGGTGCCATGGCCACGGGCGCTGTGCCCGGCGAGATCCAG GACAGATGGAAGCCTTTCTACACCTGTGGCCAGACGGCAGCCTTGGAGATTGGAAGTCCTTCAGCTGCCA CTGTTACTGGGGCTGGGCTGGCCCCACCTGCCAGGAGCCCAGGCCTGGGCCTAAAGAAGCAGTATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001200032 |
ORF Size | 417 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001200032.1, NP_001186961.1 |
RefSeq Size | 1089 |
RefSeq ORF | 417 |
Locus ID | 8372 |
Protein Families | Secreted Protein |
Protein Pathways | Glycosaminoglycan degradation, Metabolic pathways |
Gene Summary | This gene encodes a member of the hyaluronidase family. Hyaluronidases are endoglycosidase enzymes that degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. The regulated turnover of hyaluronan plays a critical role in many biological processes including cell proliferation, migration and differentiation. The encoded protein may also play an important role in sperm function. This gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression, and the expression of specific transcript variants may be indicative of tumor status. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and some isoforms may lack hyaluronidase activity. This gene overlaps and is on the same strand as N-acetyltransferase 6 (GCN5-related), and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (4), also known as HYAL3-v3, initiates translation at an upstream start codon and has multiple differences in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (4) is shorter and has a distinct N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.