UBE2E1 (NM_001202476) Human Untagged Clone
CAT#: SC329663
UBE2E1 (untagged) - Homo sapiens ubiquitin-conjugating enzyme E2E 1 (UBE2E1), transcript variant 3
"NM_001202476" in other vectors (2)
Product Images
Other products for "UBE2E1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | UBE2E1 |
Synonyms | UBCH6 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001202476, the custom clone sequence may differ by one or more nucleotides
ATGAAGGAAGTGGGCAGACCCCGGGAAGTTAGAGGACGCCCGGGGAAAAGCAGAATTCAGAAGGAGCTGG CGGACATCACTTTAGACCCTCCACCTAATTGCAGTGCTGGTCCCAAAGGCGATAACATCTATGAATGGAG ATCAACCATTCTAGGGCCTCCAGGATCCGTGTATGAGGGTGGTGTATTCTTTCTCGATATCACTTTTACA CCAGAATATCCCTTCAAGCCTCCAAAGGTTACATTTCGGACAAGAATCTATCATTGTAATATTAACAGTC AAGGTGTTATTTGCTTGGACATATTGAAAGATAATTGGAGTCCAGCACTAACCATTTCTAAAGTCCTCCT TTCTATCTGCTCACTTCTTACAGACTGTAATCCTGCCGACCCCTTGGTGGGAAGTATTGCCACTCAGTAT ATGACCAACAGAGCAGAACATGACAGAATGGCCAGACAGTGGACCAAGAGATACGCTACATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001202476 |
ORF Size | 483 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001202476.1, NP_001189405.1 |
RefSeq Size | 1550 |
RefSeq ORF | 483 |
Locus ID | 7324 |
Protein Pathways | Ubiquitin mediated proteolysis |
Gene Summary | The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (3) lacks two exons from the 5' end and has an alternate 5' exon, as comapred to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.