ATP6V1G2 (NM_001204078) Human Untagged Clone

CAT#: SC329698

ATP6V1G2 (untagged) - Homo sapiens ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2 (ATP6V1G2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATP6V1G2
• Synonyms: ATP6G; ATP6G2; NG38; VMA10
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204078, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCAGTCAGTCCCAAGGTATCCAGCAGCTTCTGCAAGCTGAGAAGCGGGCAGCTGAGAAGGTGGCAG
  ATGCCAGAAAGAGGAAGGCCCGGCGACTGAAGCAGGCTACAAGGCGCCAGGTGCAGGGCATGCAGAGCTC
  CCAGCAGAGAAACCGAGAGCGTGTCCTGGCCCAGCTTCTTGGCATGGTCTGCGACGTCAGGCCCCAGGTC
  CACCCCAACTACCGGATTTCTGCCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204078
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001204078.1, NP_001191007.1
• RefSeq Size: 1483 bp
• RefSeq ORF: 237 bp
• Locus ID: 534
• Cytogenetics: 6p21.33
• Protein Pathways: Epithelial cell signaling in Helicobacter pylori infection, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection
• Gene Summary: 'This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of three V1 domain G subunit proteins. This gene had previous gene symbols of ATP6G and ATP6G2. Alternatively spliced transcript variants encoding different isoforms have been described. Read-through transcription also exists between this gene and the downstream DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B (DDX39B) gene. [provided by RefSeq, Feb 2011]'
  Transcript Variant: This variant (3) uses two alternate splice sites that result in the loss of an in-frame segment in the central coding region, compared to variant 1. The encoded isoform (c) is shorter than isoform a.