PITX2 (NM_001204398) Human Untagged Clone
CAT#: SC329748
PITX2 (untagged) - Homo sapiens paired-like homeodomain 2 (PITX2), transcript variant 5
"NM_001204398" in other vectors (2)
Product Images
Other products for "PITX2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PITX2 |
Synonyms | ARP1; ASGD4; Brx1; IDG2; IGDS; IGDS2; IHG2; IRID2; Otlx2; PTX2; RGS; RIEG; RIEG1; RS |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001204398, the custom clone sequence may differ by one or more nucleotides
ATGGAGACCAACTGCCGCAAACTGGTGTCGGCGTGTGTGCAATTAGGCGTGCAGCCGGCGGCCGTTGAAT GTCTCTTCTCCAAAGACTCCGAAATCAAAAAGGTCGAGTTCACGGACTCTCCTGAGAGCCGAAAAGAGGC AGCCAGCAGCAAGTTCTTCCCGCGGCAGCATCCTGGCGCCAATGAGAAAGATAAAAGCCAGCAGGGGAAG AATGAGGACGTGGGCGCCGAGGACCCGTCTAAGAAGAAGCGGCAAAGGCGGCAGCGGACTCACTTTACCA GCCAGCAGCTCCAGGAGCTGGAGGCCACTTTCCAGAGGAACCGCTACCCGGACATGTCCACACGCGAAGA AATCGCTGTGTGGACCAACCTTACGGAAGCCCGAGTCCGGGTTTGGTTCAAGAATCGTCGGGCCAAATGG AGAAAGAGGGAGCGCAACCAGCAGGCCGAGCTATGCAAGAATGGCTTCGGGCCGCAGTTCAATGGGCTCA TGCAGCCCTACGACGACATGTACCCAGGCTATTCCTACAACAACTGGGCCGCCAAGGGCCTTACATCCGC CTCCCTATCCACCAAGAGCTTCCCCTTCTTCAACTCTATGAACGTCAACCCCCTGTCATCACAGAGCATG TTTTCCCCACCCAACTCTATCTCGTCCATGAGCATGTCGTCCAGCATGGTGCCCTCAGCAGTGACAGGCG TCCCGGGCTCCAGTCTCAACAGCCTGAATAACTTGAACAACCTGAGTAGCCCGTCGCTGAATTCCGCGGT GCCGACGCCTGCCTGTCCTTACGCGCCGCCGACTCCTCCGTATGTTTATAGGGACACGTGTAACTCGAGC CTGGCCAGCCTGAGACTGAAAGCAAAGCAGCACTCCAGCTTCGGCTACGCCAGCGTGCAGAACCCGGCCT CCAACCTGAGTGCTTGCCAGTATGCAGTGGACCGGCCCGTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204398 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001204398.1, NP_001191327.1 |
RefSeq Size | 1874 bp |
RefSeq ORF | 954 bp |
Locus ID | 5308 |
Cytogenetics | 4q25 |
Protein Families | Transcription Factors |
Protein Pathways | TGF-beta signaling pathway |
Gene Summary | 'This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. The encoded protein acts as a transcription factor and regulates procollagen lysyl hydroxylase gene expression. This protein plays a role in the terminal differentiation of somatotroph and lactotroph cell phenotypes, is involved in the development of the eye, tooth and abdominal organs, and acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. Mutations in this gene are associated with Axenfeld-Rieger syndrome, iridogoniodysgenesis syndrome, and sporadic cases of Peters anomaly. A similar protein in other vertebrates is involved in the determination of left-right asymmetry during development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (5) lacks an exon in the 5' UTR, as compared to variant 2. Variants 2, 4 and 5 encode the same isoform b. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.