PITX2 (NM_001204399) Human Untagged Clone

CAT#: SC329749

PITX2 (untagged) - Homo sapiens paired-like homeodomain 2 (PITX2), transcript variant 6


  "NM_001204399" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PITX2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PITX2
Synonyms ARP1; ASGD4; Brx1; IDG2; IGDS; IGDS2; IHG2; IRID2; Otlx2; PTX2; RGS; RIEG; RIEG1; RS
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001204399, the custom clone sequence may differ by one or more nucleotides


ATGGAGACCAACTGCCGCAAACTGGTGTCGGCGTGTGTGCAATTAGAGAAAGATAAAAGCCAGCAGGGGA
AGAATGAGGACGTGGGCGCCGAGGACCCGTCTAAGAAGAAGCGGCAAAGGCGGCAGCGGACTCACTTTAC
CAGCCAGCAGCTCCAGGAGCTGGAGGCCACTTTCCAGAGGAACCGCTACCCGGACATGTCCACACGCGAA
GAAATCGCTGTGTGGACCAACCTTACGGAAGCCCGAGTCCGGGTTTGGTTCAAGAATCGTCGGGCCAAAT
GGAGAAAGAGGGAGCGCAACCAGCAGGCCGAGCTATGCAAGAATGGCTTCGGGCCGCAGTTCAATGGGCT
CATGCAGCCCTACGACGACATGTACCCAGGCTATTCCTACAACAACTGGGCCGCCAAGGGCCTTACATCC
GCCTCCCTATCCACCAAGAGCTTCCCCTTCTTCAACTCTATGAACGTCAACCCCCTGTCATCACAGAGCA
TGTTTTCCCCACCCAACTCTATCTCGTCCATGAGCATGTCGTCCAGCATGGTGCCCTCAGCAGTGACAGG
CGTCCCGGGCTCCAGTCTCAACAGCCTGAATAACTTGAACAACCTGAGTAGCCCGTCGCTGAATTCCGCG
GTGCCGACGCCTGCCTGTCCTTACGCGCCGCCGACTCCTCCGTATGTTTATAGGGACACGTGTAACTCGA
GCCTGGCCAGCCTGAGACTGAAAGCAAAGCAGCACTCCAGCTTCGGCTACGCCAGCGTGCAGAACCCGGC
CTCCAACCTGAGTGCTTGCCAGTATGCAGTGGACCGGCCCGTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001204399
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204399.1, NP_001191328.1
RefSeq Size 1736 bp
RefSeq ORF 816 bp
Locus ID 5308
Cytogenetics 4q25
Protein Families Transcription Factors
Protein Pathways TGF-beta signaling pathway
Gene Summary 'This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. The encoded protein acts as a transcription factor and regulates procollagen lysyl hydroxylase gene expression. This protein plays a role in the terminal differentiation of somatotroph and lactotroph cell phenotypes, is involved in the development of the eye, tooth and abdominal organs, and acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. Mutations in this gene are associated with Axenfeld-Rieger syndrome, iridogoniodysgenesis syndrome, and sporadic cases of Peters anomaly. A similar protein in other vertebrates is involved in the determination of left-right asymmetry during development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (6) lacks an exon in the 5' UTR and an in-frame exon in the 5' CDS, as compared to variant 2. The resulting isoform (a) lacks an internal segment, as compared to isoform b. Variants 1 and 6 encode the same isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.