RAD54B (NM_001205262) Human Untagged Clone

CAT#: SC329794

RAD54B (untagged) - Homo sapiens RAD54 homolog B (S. cerevisiae) (RAD54B), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAD54B
• Synonyms: RDH54
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001205262, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGACGATCTGCAGCACCAAGTCAGTTGCAGGGGAATTCCTTCAAAAAACCAAAATTTATACCTCCAG
  GAAGAAGTAATCCAGGTCTGAATGAAGAGATTACAAAACTGAATCCAGATATAAAATTATTTGAGGGTGT
  TGCAATTAATAACACCTTTCTCCCGTCACAAAATGATCTTAGAATATGCAGTTTAAATCTGCCTAGTGAA
  GAAAGTACTAGAGAAATCAATAACAGAGATAATTGCAGTGGAAAATATTGTTTTGAAGCACCTACACTGG
  CAACATTAGATCCACCTCATACAGTGCAAACTTGGATGAGGAGGCACAGGCTGGTACCAGTTCACTACAG
  GTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001205262
• ORF Size: 354 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001205262.2, NP_001192191.1
• RefSeq Size: 5380
• RefSeq ORF: 354
• Locus ID: 25788
• Protein Families: Druggable Genome
• Protein Pathways: Homologous recombination
• Gene Summary: The protein encoded by this gene belongs to the DEAD-like helicase superfamily. It shares similarity with Saccharomyces cerevisiae RAD54 and RDH54, both of which are involved in homologous recombination and repair of DNA. This protein binds to double-stranded DNA, and displays ATPase activity in the presence of DNA. This gene is highly expressed in testis and spleen, which suggests active roles in meiotic and mitotic recombination. Homozygous mutations of this gene were observed in primary lymphoma and colon cancer. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks several coding exons and uses an alternate 3' terminal exon, compared to variant 1. It encodes isoform 2, which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.