ATF3 (NM_001206488) Human Untagged Clone

CAT#: SC329813

ATF3 (untagged) - Homo sapiens activating transcription factor 3 (ATF3), transcript variant 8

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATF3
• Synonyms: FLJ41705
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001206488, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCTCTGCGCTGGAATCAGTCACTGTCAGCGACAGACCCCTCGGGGTGTCCATCACAAAAGCCGAGG
  TAGCCCCTGAAGAAGATGAAAGGAAAAAGAGGCGACGAGAAAGAAATAAGATTGCAGCTGCAAAGTGCCG
  AAACAAGAAGAAGGAGAAGACGGAGTGCCTGCAGAAAGAGTCGGAGAAGCTGGAAAGTGTGAATGCTGAA
  CTGAAGGCTCAGATTGAGGAGCTCAAGAACGAGAAGCAGCATTTGATATACATGCTCAACCTTCATCGGC
  CCACGTGTATTGTCCGGGCTCAGAATGGGAGGACTCCAGAAGATGAGAGAAACCTCTTTATCCAACAGAT
  AAAAGAAGGAACATTGCAGAGCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001206488
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001206488.2, NP_001193417.2
• RefSeq Size: 2065 bp
• RefSeq ORF: 375 bp
• Locus ID: 467
• Cytogenetics: 1q32.3
• Protein Families: Transcription Factors
• Gene Summary: 'This gene encodes a member of the mammalian activation transcription factor/cAMP responsive element-binding (CREB) protein family of transcription factors. This gene is induced by a variety of signals, including many of those encountered by cancer cells, and is involved in the complex process of cellular stress response. Multiple transcript variants encoding different isoforms have been found for this gene. It is possible that alternative splicing of this gene may be physiologically important in the regulation of target genes. [provided by RefSeq, Apr 2011]'
  Transcript Variant: This variant (8) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (3) is shorter at the N-terminus, compared to isoform 1. Both variants 5 and 8 encode isoform 3.