ATF7 (NM_001206682) Human Untagged Clone

CAT#: SC329828

ATF7 (untagged) - Homo sapiens activating transcription factor 7 (ATF7), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATF7
• Synonyms: ATFA
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001206682, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGAGACGACAGACCGTTTGTGTGCAATGCCCCGGGCTGTGGACAGAGATTTACAAACGAGGACCACC
  TGGCAGTTCATAAACACAAGCATGAGATGACATTGAAATTTGGCCCAGCCCGAACTGACTCAGTCATCAT
  TGCAGATCAAACGCCTACTCCAACTAGATTCCTGAAGAACTGTGAGGAGGTGGGACTCTTCAATGAACTA
  GCTAGCTCCTTTGAACATGAATTCAAGAAAGCTGCAGATGAGGATGAGAAAAAGGCAAGAAGCAGGACTG
  TTGCCAAAAAACTGGTGGTATTCAGACCTAGGCTATTTTTATTGTGCTTTGGGATAATTTTCTTAATTGG
  TTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001206682
• ORF Size: 354 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001206682.1, NP_001193611.1
• RefSeq Size: 867
• RefSeq ORF: 354
• Locus ID: 11016
• Protein Families: Transcription Factors
• Gene Summary: Isoform 5 acts as a negative regulator, inhibiting both ATF2 and ATF7 transcriptional activities. It may exert these effects by sequestrating in the cytoplasm the Thr-53 phosphorylating kinase, preventing activation. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) differs in the 3' coding region and 3' UTR, compared to variant 2, resulting in an isoform (4) with a distinct and shorter C-terminus, compared to isoform 2. Variants 4, 5, and 13 all encode the same isoform (4).