p21 (CDKN1A) (NM_001220778) Human Untagged Clone
CAT#: SC329916
CDKN1A (untagged) - Homo sapiens cyclin-dependent kinase inhibitor 1A (p21, Cip1) (CDKN1A), transcript variant 4
"NM_001220778" in other vectors (2)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CDKN1A |
| Synonyms | CAP20; CDKN1; CIP1; MDA-6; P21; p21CIP1; SDI1; WAF1 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001220778, the custom clone sequence may differ by one or more nucleotides
ATGTCAGAACCGGCTGGGGATGTCCGTCAGAACCCATGCGGCAGCAAGGCCTGCCGCCGCCTCTTCGGCC CAGTGGACAGCGAGCAGCTGAGCCGCGACTGTGATGCGCTAATGGCGGGCTGCATCCAGGAGGCCCGTGA GCGATGGAACTTCGACTTTGTCACCGAGACACCACTGGAGGGTGACTTCGCCTGGGAGCGTGTGCGGGGC CTTGGCCTGCCCAAGCTCTACCTTCCCACGGGGCCCCGGCGAGGCCGGGATGAGTTGGGAGGAGGCAGGC GGCCTGGCACCTCACCTGCTCTGCTGCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTG TACCCTTGTGCCTCGCTCAGGGGAGCAGGCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGA AAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCCGGCTGATCTTCTCCAAGAGGAAGC CCTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001220778 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001220778.1, NP_001207707.1 |
| RefSeq Size | 2284 bp |
| RefSeq ORF | 495 bp |
| Locus ID | 1026 |
| Cytogenetics | 6p21.2 |
| Protein Families | Druggable Genome |
| Protein Pathways | Bladder cancer, Cell cycle, Chronic myeloid leukemia, ErbB signaling pathway, Glioma, Melanoma, p53 signaling pathway, Pathways in cancer, Prostate cancer |
| Gene Summary | 'This gene encodes a potent cyclin-dependent kinase inhibitor. The encoded protein binds to and inhibits the activity of cyclin-cyclin-dependent kinase2 or -cyclin-dependent kinase4 complexes, and thus functions as a regulator of cell cycle progression at G1. The expression of this gene is tightly controlled by the tumor suppressor protein p53, through which this protein mediates the p53-dependent cell cycle G1 phase arrest in response to a variety of stress stimuli. This protein can interact with proliferating cell nuclear antigen, a DNA polymerase accessory factor, and plays a regulatory role in S phase DNA replication and DNA damage repair. This protein was reported to be specifically cleaved by CASP3-like caspases, which thus leads to a dramatic activation of cyclin-dependent kinase2, and may be instrumental in the execution of apoptosis following caspase activation. Mice that lack this gene have the ability to regenerate damaged or missing tissue. Multiple alternatively spliced variants have been found for this gene. [provided by RefSeq, Sep 2015]' Transcript Variant: This variant (4) differs in the 5' UTR, lacks an in-frame portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 3. The resulting isoform (1) has a shorter N-terminus, compared to isoform 2. Variants 1, 2, 4 and 5 encode the same isoform 1. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC231921 | CDKN1A (Myc-DDK tagged) - Homo sapiens cyclin-dependent kinase inhibitor 1A (p21, Cip1) (CDKN1A), transcript variant 4 |
USD 420.00 |
|
| RG231921 | CDKN1A (GFP-tagged) - Homo sapiens cyclin-dependent kinase inhibitor 1A (p21, Cip1) (CDKN1A), transcript variant 4 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China