MIF4GD (NM_001242501) Human Untagged Clone

CAT#: SC329974

MIF4GD (untagged) - Homo sapiens MIF4G domain containing (MIF4GD), transcript variant 4


  "NM_001242501" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MIF4GD"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MIF4GD
Synonyms AD023; MIFD; SLIP1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001242501, the custom clone sequence may differ by one or more nucleotides


ATGGGGGAGCCCAGTAGAGAGGAGTATAAAATCCAGTCCTTTGATGCAGAGACCCAGCAGCTGCTGAAGA
CAGCACTCAAAGATCCGGGTGCTGTGGACTTGGAGAAAGTGGCCAATGTGATTGTGGACCATTCTCTGCA
GGACTGTGTGTTCAGCAAGGAAGCAGGACGCATGTGCTACGCCATCATTCAGGCAGAGAGTAAACAAGCA
GGCCAGAGTGTCTTCCGACGTGGACTCCTCAACCGGCTGCAGCAGGAGTACCAGGCTCGGGAGCAGCTGC
GAGCACGCTCCCTGCAGGGCTGGGTCTGCTATGTCACCTTTATCTGCAACATCTTTGACTACCTGAGGGT
GAACAACATGCCCATGATGGCCCTGGTGAACCCTGTCTATGACTGCCTCTTCCGGCTGGCCCAGCCAGAC
AGTTTGAGCAAGGAGGAGGAGGTGGACTGTTTGGTGCTGCAGCTGCACCGGGTTGGGGAGCAGCTGGAGA
AAATGAATGGGCAGCGCATGGATGAGCTCTTTGTGCTGATCCGGGATGGCTTCCTGCTCCCAACTGGCCT
CAGCTCCCTGGCCCAGCTGCTGCTGCTGGAGATCATTGAGTTCCGGGCGGCCGGCTGGAAGACAACGCCA
GCTGCCCACAAGTATTACTACAGCGAAGTCTCCGACTAG


Restriction Sites SgfI-MluI     
ACCN NM_001242501
ORF Size 669 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001242501.1, NP_001229430.1
RefSeq Size 1262
RefSeq ORF 669
Locus ID 57409
Gene Summary This gene encodes a protein which interacts with the N-terminus of the stem-loop binding protein (SLBP) and the 3' end of histone mRNA. This interaction facilitates the activation of histone mRNA translation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
Transcript Variant: This variant (4), as well as variants 7-10, encodes isoform (4).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.