FDPS (NM_001242825) Human Untagged Clone

CAT#: SC330022

FDPS (untagged) - Homo sapiens farnesyl diphosphate synthase (FDPS), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FDPS
• Synonyms: FPPS; FPS; POROK9
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001242825, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATTCATCCCTTACCCGCCGGGGACAGATCTGCTGGTATCAGAAGCCGGGCGTGGGTTTGGATGCCA
  TCAATGATGCTAACCTCCTGGAAGCATGTATCTACCGCCTGCTGAAGCTCTATTGCCGGGAGCAGCCCTA
  TTACCTGAACCTGATCGAGCTCTTCCTGCAGAGTTCCTATCAGACTGAGATTGGGCAGACCCTGGACCTC
  CTCACAGCCCCCCAGGGCAATGTGGATCTTGTCAGATTCACTGAAAAGAGGTACAAATCTATTGTCAAGT
  ACAAGACAGCTTTCTACTCCTTCTACCTTCCTATAGCTGCAGCCATGTACATGGCAGGAATTGATGGCGA
  GAAGGAGCACGCCAATGCCAAGAAGATCCTGCTGGAGATGGGGGAGTTCTTTCAGATTCAGGATGATTAC
  CTTGACCTCTTTGGGGACCCCAGTGTGACCGGCAAAATTGGCACTGACATCCAGGACAACAAATGCAGCT
  GGCTGGTGGTTCAGTGTCTGCAACGGGCCACTCCAGAACAGTACCAGATCCTGAAGGAAAATTACGGGCA
  GAAGGAGGCTGAGAAAGTGGCCCGGGTGAAGGCGCTATATGAGGAGCTGGATCTGCCAGCAGTGTTCTTG
  CAATATGAGGAAGACAGTTACAGCCACATTATGGCTCTCATTGAACAGTACGCAGCACCCCTGCCCCCAG
  CCGTCTTTCTGGGGCTTGCGCGCAAAATCTACAAGCGGAGAAAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001242825
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001242825.1, NP_001229754.1
• RefSeq Size: 1215 bp
• RefSeq ORF: 747 bp
• Locus ID: 2224
• Cytogenetics: 1q22
• Protein Families: Druggable Genome
• Protein Pathways: Metabolic pathways, Terpenoid backbone biosynthesis
• Gene Summary: 'This gene encodes an enzyme that catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Multiple pseudogenes have been found on chromosomes 1, 7, 14, 15, 21 and X. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]'
  Transcript Variant: This variant (5) lacks two alternate exons at its 5' end and uses a downstream translation initiation codon, compared to variant 1. The resulting isoform (c) has a shorter N-terminus when compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.