CD64 (FCGR1B) (NM_001244910) Human Untagged Clone

CAT#: SC330230

FCGR1B (untagged) - Homo sapiens Fc fragment of IgG, high affinity Ib, receptor (CD64) (FCGR1B), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FCGR1B
• Synonyms: CD64b; FCG1; FcgammaRIa; FCGR1; FCGR1A; FcRI; IGFR1; IGFRB
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001244910, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTGGTTCTTGACAACTCTGCTCCTTTGGGTTCCAGTTGATGGGCAAGTGGACACCACAAAGGCAGTGA
  TCACTTTGCAGCCTCCATGGGTCAGCGTGTTCCAAGAGGAAACCGTAACCTTGCACTGTGAGGTGCTCCA
  TCTGCCTGGGAGCAGCTCCACACAGTGGTTTCTCAATGGCACAGCCACTCAGACCTCGACCCCCAGCTAC
  AGAATCACCTCTGCCAGTGTCAATGACAGTGGTGAATACAGGTGCCAGAGAGGTCTCTCAGGGCGAAGTG
  ACCCCATACAGCTGGAAATCCACAGAGGCTGGCTACTACTGCAGGTCTCCAGCAGAGTCTTCATGGAAGG
  AGAACCTCTGGCCTTGAGGTGTCATGCGTGGAAGGATAAGCTGGTGTACAATGTGCTTTACTATCGAAAT
  GGCAAAGCCTTTAAGTTTTTCCACTGGAATTCTAACCTCACCATTCTGAAAACCAACATAAGTCACAATG
  GCACCTACCATTGCTCAGGCATGGGAAAGCATCGCTACACATCAGCAGGAATATCACAATACACTGTGAA
  AGAGCTATTTCCAGCTCCAGTGCTGAATGCATCTGTGACATCCCCACTCCTGGAGGGGAATCTGGTCACC
  CTGAGCTGTGAAACAAAGTTGCTCTTGCAGAGGCCTGGTTTGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001244910
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001244910.1, NP_001231839.1
• RefSeq Size: 1581 bp
• RefSeq ORF: 675 bp
• Locus ID: 2210
• Cytogenetics: 1p11.2
• Protein Families: Transmembrane
• Gene Summary: 'Three distinct, but closely related classes of receptors that bind the Fc portion of IgG have been identified (Fcgamma RI, II and III). The FcgammaRI family consists of three closely related genes termed A, B, and C. This gene likely encodes a non-functional protein that is not detectable at the cell surface and binds ligand with low affinity. [provided by RefSeq, Nov 2019]'
  Transcript Variant: This variant (3) contains an alternate 3' terminal exon compared to variant 1. This results in a shorter isoform (3) with a distinct C-terminus compared to isoform 1.