TOR2A (NM_001252021) Human Untagged Clone

CAT#: SC330262

TOR2A (untagged) - Homo sapiens torsin family 2, member A (TOR2A), transcript variant 7


  "NM_001252021" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TOR2A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TOR2A
Synonyms TORP1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001252021, the custom clone sequence may differ by one or more nucleotides


ATGGACAAGATGCCCCCAGGCCTGATGGAAGTCCTGCGGCCTTTCCTGGGCTCCTCCTGGGTGGTATACG
GGACCAATTACCGCAAAGCCATCTTCATCTTCATCAGCAACACGGGTGGCGAGCAGATCAACCAGGTGGC
ATTGGAGGCGTGGCGCAGCCGGCGGGACCGCGAGGAGATCCTCCTGCAGGAGCTGGAGCCGGTCATCTCC
CGCGCGGTGCTGGACAACCCGCACCATGGCTTCTCAAACTCGGGCATCATGGAAGAGCGCCTCCTAGACG
CAGTGGTGCCCTTCCTCCCGCTCCAGCGGCACCACGTCCGGCACTGCGTGCTCAACGAGCTGGCCCAGCT
GGGCCTGGAGCCAAGGGATGAGGTTGTCCAGGCTGTGCTGGACAGCACCACCTTCTTCCCTGAAGACGAG
CAGCTCTTCTCCTCCAACGGCTGCAAGACCGTGGCCTCCCGAATCGCCTTCTTCCTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001252021
ORF Size 480 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001252021.1, NP_001238950.1
RefSeq Size 1319
RefSeq ORF 480
Locus ID 27433
Protein Families Secreted Protein, Transmembrane
Gene Summary This gene encodes a member of the AAA family of adenosine triphosphatases with similarity to Clp proteases and heat shock proteins. Alternative splicing at this locus results in the translation of multiple isoforms of the encoded protein, some of which contain salusin peptides in the C-terminal region. These peptides may play roles in hypotension, myocardial growth and the induction of mitogenesis, and may also be involved in the pathogenesis of atherosclerosis. The antimicrobial peptide salusin-beta has antibacterial activity. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (7) uses an alternate splice site, lacks an exon and uses a downstream, in-frame start codon, compared to variant 1. Variants 6 and 7 encode the same isoform (f), which has a shorter N-terminus compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.