THTPA (NM_001256062) Human Untagged Clone

CAT#: SC330354

THTPA (untagged) - Homo sapiens thiamine triphosphatase (THTPA), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: THTPA
• Synonyms: THTP; THTPASE
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256062, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCCAGGGCTTGATTGAGGTGGAGCGAAAGTTCCTTCCAGGGCCTGGCACAGAGGAGCGGCTGCAGG
  AGTTGGGGGGCACCCTGGAGTACCGGGTCACCTTCCGAGACACCTACTATGACACCCCTGAGCTGAGCCT
  CATGCAGGCTGACCACTGGCTGCGACGACGAGAGGATAGTGGATGGGAGCTCAAATGTCCTGGAGCAGCA
  GGTGTCTTAGGACCCCACACGGAGTATAAGGAACTCACAGCGGAACCTACAATTGTGGCCCAACTCTGTA
  AGGTGTGCCTGCACAGGAGACAGCACCAGCCAAGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256062
• ORF Size: 318 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256062.2, NP_001242991.1
• RefSeq Size: 1963
• RefSeq ORF: 318
• Locus ID: 79178
• Protein Pathways: Metabolic pathways, Thiamine metabolism
• Gene Summary: This gene encodes an enzyme which catalyzes the biosynthesis of thiamine disphophate (vitamin B1) by hydrolysis of thiamine triphosphate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (4) uses an alternate splice site that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (2) has a distinct and shorter C-terminus, compared to isoform 1. Both variants 4 and 5 encode isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.