Kallikrein 2 (KLK2) (NM_001256080) Human Untagged Clone

CAT#: SC330358

KLK2 (untagged) - Homo sapiens kallikrein-related peptidase 2 (KLK2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KLK2
• Synonyms: hGK-1; hK2; KLK2A2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256080, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCCTTCTGAAGCATCAAAGCCTTAGACCAGATGAAGACTCCAGCCATGACCTCATGCTGCTCCGCC
  TGTCAGAGCCTGCCAAGATCACAGATGTTGTGAAGGTCCTGGGCCTGCCCACCCAGGAGCCAGCACTGGG
  GACCACCTGCTACGCCTCAGGCTGGGGCAGCATCGAACCAGAGGAGTTCTTGCGCCCCAGGAGTCTTCAG
  TGTGTGAGCCTCCATCTCCTGTCCAATGACATGTGTGCTAGAGCTTACTCTGAGAAGGTGACAGAGTTCA
  TGTTGTGTGCTGGGCTCTGGACAGGTGGTAAAGACACTTGTGGGGGTGATTCTGGGGGTCCACTTGTCTG
  TAATGGTGTGCTTCAAGGTATCACATCATGGGGCCCTGAGCCATGTGCCCTGCCTGAAAAGCCTGCTGTG
  TACACCAAGGTGGTGCATTACCGGAAGTGGATCAAGGACACCATCGCAGCCAACCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256080
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256080.1, NP_001243009.1
• RefSeq Size: 2695 bp
• RefSeq ORF: 480 bp
• Locus ID: 3817
• Cytogenetics: 19q13.33
• Protein Families: Druggable Genome, Protease
• Gene Summary: 'This gene encodes a member of the grandular kallikrein protein family. Kallikreins are a subgroup of serine proteases that are clustered on chromosome 19. Members of this family are involved in a diverse array of biological functions. The protein encoded by this gene is a highly active trypsin-like serine protease that selectively cleaves at arginine residues. This protein is primarily expressed in prostatic tissue and is responsible for cleaving pro-prostate-specific antigen into its enzymatically active form. This gene is highly expressed in prostate tumor cells and may be a prognostic maker for prostate cancer risk. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Jan 2012]'
  Transcript Variant: This variant (3) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (3) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.