CHIT1 (NM_001256125) Human Untagged Clone
CAT#: SC330368
CHIT1 (untagged) - Homo sapiens chitinase 1 (chitotriosidase) (CHIT1), transcript variant 2
"NM_001256125" in other vectors (2)
Product Images
Other products for "CHIT1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CHIT1 |
Synonyms | CHI3; CHIT; CHITD |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001256125, the custom clone sequence may differ by one or more nucleotides
ATGGTGCGGTCTGTGGCCTGGGCAGGTTTCATGGTCCTGCTGATGATCCCATGGGGCTCTGCTGCAAAAC TGGTCTGCTACTTCACCAACTGGGCCCAGTACAGACAGGGGGAGGCTCGCTTCCTGCCCAAGGACTTGGA CCCCAGCCTTTGCACCCACCTCATCTACGCCTTCGCTGGCATGACCAACCACCAGCTGAGCACCACTGAG TGGAATGACGAGACTCTCTACCAGGAGTTCAATGGCCTGAAGAAGATGTTCACAGATATGGTAGCCACGG CCAACAACCGTCAGACCTTTGTCAACTCGGCCATCAGGTTTCTGCGCAAATACAGCTTTGACGGCCTTGA CCTTGACTGGGAGTACCCAGGAAGCCAGGGGAGCCCTGCCGTAGACAAGGAGCGCTTCACAACCCTGGTA CAGGACTTGGCCAATGCCTTCCAGCAGGAAGCCCAGACCTCAGGGAAGGAACGCCTTCTTCTGAGTGCAG CGGTTCCAGCTGGGCAGACCTATGTGGATGCTGGATACGAGGTGGACAAAATCGCCCAGAACCTGGATTT TGTCAACCTTATGGCCTACGACTTCCATGGCTCTTGGGAGAAGGTCACGGGACATAACAGCCCCCTCTAC AAGAGGCAAGAAGAGAGTGGTGCAGCAGCCAGCCTCAACGTGGATGCTGCTGTGCAACAGTGGCTGCAGA AGGGGACCCCTGCCAGCAAGCTGATCCTTGGCATGCCTACCTACGGACGCTCCTTCACACTGGCCTCCTC ATCAGACACCAGAGTGGGGGCCCCAGCCACAGGGTCTGGCACTCCAGGCCCCTTCACCAAGGAAGGAGGG ATGCTGGCCTACTATGAAGTCTGCTCCTGGAAGGGGGCCACCAAACAGAGAATCCAGGATCAGAAGGTGC CCTACATCTTCCGGGACAACCAGTGGGTGGGCTTTGATGATGTGGAGAGCTTCAAAACCAAGGTCAGCTA TCTGAAGCAGAAGGGACTGGGCGGGGCCATGGTCTGGGCACTGGACTTAGATGACTTTGCCGGCTTCTCC TGCAACCAGGGCCGATACCCCCTCATCCAGACGCTACGGCAGGAACTGAGTCTTCCATACTTGCCTTCAG GCACCCCAGAGCTTGAAGTTCCAAAACCAGGTCAGCCCTCTGAACCTGAGCATGGCCCCAGCCCTGGACA AGACACGTTCTGCCAGGGCAAAGCTGATGGGCTCTATCCCAATCCTCGGGAACGGTCCAGCTTCTACAGC TGTGCAGCGGGGCGGCTGTTCCAGCAAAGCTGCCCGACAGGCCTGGTGTTCAGCAACTCCTGCAAATGCT GCACCTGGAATTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256125 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001256125.1, NP_001243054.2 |
RefSeq Size | 2268 bp |
RefSeq ORF | 1344 bp |
Locus ID | 1118 |
Cytogenetics | 1q32.1 |
Protein Families | Secreted Protein, Transmembrane |
Protein Pathways | Amino sugar and nucleotide sugar metabolism |
Gene Summary | 'Chitotriosidase is secreted by activated human macrophages and is markedly elevated in plasma of Gaucher disease patients. The expression of chitotriosidase occurs only at a late stage of differentiation of monocytes to activated macrophages in culture. Human macrophages can synthesize a functional chitotriosidase, a highly conserved enzyme with a strongly regulated expression. This enzyme may play a role in the degradation of chitin-containing pathogens. Several alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2012]' Transcript Variant: This variant (2) lacks an in-frame exon in the 5' coding region, compared to variant 1. The resulting isoform (2) is shorter, compared to isoform 1. Sequence Note: A downstream translational start codon is selected for this RefSeq based on its better conservation in mammalian species and on the presence of a predicted signal peptide in the protein N-terminus. An upstream in-frame start codon is also present but is poorly conserved, and use of the upstream start codon would result in a protein that is 10 aa longer at the N-terminus and lacks a predicted signal peptide. Leaky scanning by ribosomes may allow translation initiation at the downstream start codon. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.