RAB34 (NM_001256276) Human Untagged Clone
CAT#: SC330387
RAB34 (untagged) - Homo sapiens RAB34, member RAS oncogene family (RAB34), transcript variant 7
"NM_001256276" in other vectors (2)
Product Images
Other products for "RAB34"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RAB34 |
Synonyms | NARR; RAB39; RAH |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001256276, the custom clone sequence may differ by one or more nucleotides
ATGAACATTCTGGCACCCGTGCGGAGGGATCGCGTCCTGGCGGAGCTGCCCCAGTGCCTGAGGAAGGAGG CCGCTTTGCACGGGCACAAAGACTTCCACCCCCGCGTCACCTGCGCCTGCCAGGAGCACCGGACAGGCAC CGTGGGGTTCTGCAAAGACACCTTTGATAAGAATTACAAGGCCACCATTGGAGTGGACTTCGAGATGGAA CGATTTGAGGTGCTGGGCATTCCCTTCAGTTTGCAGCTTTGGGATACCGCTGGGCAGGAGAGGTTCAAAT GCATTGCATCAACCTACTATAGAGGAGCTCAAGCCATCATCATTGTCTTCAACCTGAATGATGTGGCATC TCTGGAACATACCAAGCAGTGGCTGGCCGATGCCCTGAAGGAGAATGACCCTTCCAGTGTGCTTCTCTTC CTTGTAGGTTCCAAGAAGGATCTGAGTACCCCTGCTCAGTATGCGCTGATGGAGAAAGACGCCCTCCAGG TGGCCCAGGAGATGAAGGCTGAGTACTGGGCAGTCTCATCTCTCACTGGTGAGAATGTCCGAGAATTCTT CTTCCGTGTGGCAGCACTGACCTTTGAGGCCAATGTGCTGGCTGAGCTGGAGAAATCGGGGGCTCGACGC ATTGGGGATGTTGTCCGCATCAACAGTGATGACAGCAACCTCTACCTAACTGCCAGCAAGAAGAAGCCCA CATGTTGCCCATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256276 |
ORF Size | 714 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001256276.1, NP_001243205.1 |
RefSeq Size | 1401 |
RefSeq ORF | 714 |
Locus ID | 83871 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. An alternatively spliced transcript variant produces the nine-amino acid residue-repeats (NARR) protein, which is a functionally distinct nucleolar protein resulting from a different reading frame. [provided by RefSeq, Dec 2016] Transcript Variant: This variant (7) differs in the 5' UTR and lacks an alternate in-frame exon in the 5' coding region, compared to variant 1, resulting in an isoform (6) that is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.