RAB34 (NM_001256276) Human Untagged Clone

CAT#: SC330387

RAB34 (untagged) - Homo sapiens RAB34, member RAS oncogene family (RAB34), transcript variant 7


  "NM_001256276" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RAB34"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAB34
Synonyms NARR; RAB39; RAH
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256276, the custom clone sequence may differ by one or more nucleotides


ATGAACATTCTGGCACCCGTGCGGAGGGATCGCGTCCTGGCGGAGCTGCCCCAGTGCCTGAGGAAGGAGG
CCGCTTTGCACGGGCACAAAGACTTCCACCCCCGCGTCACCTGCGCCTGCCAGGAGCACCGGACAGGCAC
CGTGGGGTTCTGCAAAGACACCTTTGATAAGAATTACAAGGCCACCATTGGAGTGGACTTCGAGATGGAA
CGATTTGAGGTGCTGGGCATTCCCTTCAGTTTGCAGCTTTGGGATACCGCTGGGCAGGAGAGGTTCAAAT
GCATTGCATCAACCTACTATAGAGGAGCTCAAGCCATCATCATTGTCTTCAACCTGAATGATGTGGCATC
TCTGGAACATACCAAGCAGTGGCTGGCCGATGCCCTGAAGGAGAATGACCCTTCCAGTGTGCTTCTCTTC
CTTGTAGGTTCCAAGAAGGATCTGAGTACCCCTGCTCAGTATGCGCTGATGGAGAAAGACGCCCTCCAGG
TGGCCCAGGAGATGAAGGCTGAGTACTGGGCAGTCTCATCTCTCACTGGTGAGAATGTCCGAGAATTCTT
CTTCCGTGTGGCAGCACTGACCTTTGAGGCCAATGTGCTGGCTGAGCTGGAGAAATCGGGGGCTCGACGC
ATTGGGGATGTTGTCCGCATCAACAGTGATGACAGCAACCTCTACCTAACTGCCAGCAAGAAGAAGCCCA
CATGTTGCCCATGA


Restriction Sites SgfI-MluI     
ACCN NM_001256276
ORF Size 714 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256276.1, NP_001243205.1
RefSeq Size 1401
RefSeq ORF 714
Locus ID 83871
Protein Families Druggable Genome
Gene Summary This gene encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. An alternatively spliced transcript variant produces the nine-amino acid residue-repeats (NARR) protein, which is a functionally distinct nucleolar protein resulting from a different reading frame. [provided by RefSeq, Dec 2016]
Transcript Variant: This variant (7) differs in the 5' UTR and lacks an alternate in-frame exon in the 5' coding region, compared to variant 1, resulting in an isoform (6) that is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.