RAB34 (NM_001256278) Human Untagged Clone

CAT#: SC330389

RAB34 (untagged) - Homo sapiens RAB34, member RAS oncogene family (RAB34), transcript variant 9

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAB34
• Synonyms: NARR; RAB39; RAH
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256278, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGTCACCTCCCAGGCCTGGAGTTGAGGAGGGAAGCGCCGCCTCTCCTTGGGCCCCTTCTCTCCCCCT
  TTCCCCTCCCTGCTGGTTCCTGGCATCGCCAGATGCTGCGCAGCAGTCTCCGATTCCCCATCACCAATTC
  GGCTGGATTTAAGATCTCCAAGGTCATTGTGGTGGGGGACCTGTCGGTGGGGAAGACTTGCCTCATTAAT
  AGGTTCTGCAAAGACACCTTTGATAAGAATTACAAGGCCACCATTGGAGTGGACTTCGAGATGGAACGAT
  TTGAGGTGCTGGGCATTCCCTTCAGTTTGCAGCTTTGGGATACCGCTGGGCAGGAGAGGTTCAAATGCAT
  TGCATCAACCTACTATAGAGGAGCTCAAGCCATCATCATTGTCTTCAACCTGAATGATGTGGCATCTCTG
  GAACATACCAAGCAGTGGCTGGCCGATGCCCTGAAGGAGAATGACCCTTCCAGTGTGCTTCTCTTCCTTG
  TAGGTTCCAAGAAGGATCTGAGTACCCCTGCTCAGTATGCGCTGATGGAGAAAGACGCCCTCCAGGTGGC
  CCAGGAGATGAAGGCTGAGTACTGGGCAGTCTCATCTCTCACTGGTGAGAATGTCCGAGAATTCTTCTTC
  CGTGTGGCAGCACTGACCTTTGAGGCCAATGTGCTGGCTGAGCTGGAGAAATCGGGGGCTCGACGCATTG
  GGGATGTTGTCCGCATCAACAGTGATGACAGCAACCTCTACCTAACTGCCAGCAAGAAGAAGCCCACATG
  TTGCCCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256278
• ORF Size: 780 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256278.1, NP_001243207.1
• RefSeq Size: 1162
• RefSeq ORF: 780
• Locus ID: 83871
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. An alternatively spliced transcript variant produces the nine-amino acid residue-repeats (NARR) protein, which is a functionally distinct nucleolar protein resulting from a different reading frame. [provided by RefSeq, Dec 2016]
  Transcript Variant: This variant (9) uses alternate 5' exon structure and thus differs in the 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (7) has a distinct N-terminus but is overall the same length as isoform 1.