THTPA (NM_001256322) Human Untagged Clone
CAT#: SC330395
THTPA (untagged) - Homo sapiens thiamine triphosphatase (THTPA), transcript variant 6
"NM_001256322" in other vectors (2)
Product Images
Other products for "THTPA"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | THTPA |
Synonyms | THTP; THTPASE |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001256322, the custom clone sequence may differ by one or more nucleotides
ATGGCCCAGGGCTTGATTGAGGTGGAGCGAAAGTTCCTTCCAGGGCCTGGCACAGAGGAGCGGCTGCAGG AGTTGGGGGGCACCCTGGAGTACCGGGTCACCTTCCGAGACACCTACTATGACACCCCTGAGCTGAGCCT CATGCAGGCTGACCACTGGCTGCGACGACGAGAGGATAGTGGATGGGAGCTCAAATGTCCTGGAGCAGCA GGTGTCTTAGGACCCCACACGGAGTATAAGGAACTCACAGCGGAACCTACAATTGTGGCCCAACTCTGTG TGCCTGCACAGGAGACAGCACCAGCCAAGCTGATTGTGTATCTACAGCGTTTCCGGCCTCAAGACTATCA GCGCCTGCTAGAAGTGAACAGCTCCAGAGAGAGGCCACAGGAGACTGAAGATCCTGACCACTGCCTGGGC TAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256322 |
ORF Size | 423 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001256322.2, NP_001243251.1 |
RefSeq Size | 1958 |
RefSeq ORF | 423 |
Locus ID | 79178 |
Protein Pathways | Metabolic pathways, Thiamine metabolism |
Gene Summary | This gene encodes an enzyme which catalyzes the biosynthesis of thiamine disphophate (vitamin B1) by hydrolysis of thiamine triphosphate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (6) uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in an isoform (3) that is shorter than isoform 1. Both variants 6 and 7 encode isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.