THTPA (NM_001256322) Human Untagged Clone

CAT#: SC330395

THTPA (untagged) - Homo sapiens thiamine triphosphatase (THTPA), transcript variant 6


  "NM_001256322" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "THTPA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol THTPA
Synonyms THTP; THTPASE
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256322, the custom clone sequence may differ by one or more nucleotides


ATGGCCCAGGGCTTGATTGAGGTGGAGCGAAAGTTCCTTCCAGGGCCTGGCACAGAGGAGCGGCTGCAGG
AGTTGGGGGGCACCCTGGAGTACCGGGTCACCTTCCGAGACACCTACTATGACACCCCTGAGCTGAGCCT
CATGCAGGCTGACCACTGGCTGCGACGACGAGAGGATAGTGGATGGGAGCTCAAATGTCCTGGAGCAGCA
GGTGTCTTAGGACCCCACACGGAGTATAAGGAACTCACAGCGGAACCTACAATTGTGGCCCAACTCTGTG
TGCCTGCACAGGAGACAGCACCAGCCAAGCTGATTGTGTATCTACAGCGTTTCCGGCCTCAAGACTATCA
GCGCCTGCTAGAAGTGAACAGCTCCAGAGAGAGGCCACAGGAGACTGAAGATCCTGACCACTGCCTGGGC
TAG


Restriction Sites SgfI-MluI     
ACCN NM_001256322
ORF Size 423 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256322.2, NP_001243251.1
RefSeq Size 1958
RefSeq ORF 423
Locus ID 79178
Protein Pathways Metabolic pathways, Thiamine metabolism
Gene Summary This gene encodes an enzyme which catalyzes the biosynthesis of thiamine disphophate (vitamin B1) by hydrolysis of thiamine triphosphate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (6) uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in an isoform (3) that is shorter than isoform 1. Both variants 6 and 7 encode isoform 3.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.