QTRTD1 (QTRT2) (NM_001256837) Human Untagged Clone

CAT#: SC330531

QTRTD1 (untagged) - Homo sapiens queuine tRNA-ribosyltransferase domain containing 1 (QTRTD1), transcript variant 4


  "NM_001256837" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "QTRT2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol QTRT2
Synonyms QTRTD1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256837, the custom clone sequence may differ by one or more nucleotides


ATGACTGTTTCCAAGTTCATGGCAATTCAGAAGGCCCTTCAGCCAGACTGGTTCCAGTGCCTCTCCGATG
GAGAAGTATCTTGTAAGGAAGCAACTTCCATAAAAAGGGTCAGAAAGTCTGTTGACCGATCACTTCTTTT
CTTGGATAACTGTCTGCGGCTGCAGGAAGAGTCAGAGGTTCTTCAGAAGAGTGTGATCATTGGAGTGATT
GAAGGTGGAGATGTGATGGAAGAGAGGCTGAGGTCAGCACGAGAGACAGCCAAGCGGCCTGTGGGTGGCT
TCCTTCTGGATGGTTTTCAAGGAAATCCAACAACCCTGGAGGCTAGACTACGCTTGCTGTCATCAGTCAC
TGCAGAGCTGCCGGAGGACAAGCCAAGGCTCATATCTGGTGTTAGTCGGCCAGATGAGGTGCTCGAGTGT
ATTGAAAGAGGAGTGGACTTATTTGAGAGTTTTTTCCCTTATCAAGTAACAGAGCGGGGATGTGCCCTGA
CTTTCAGTTTTGATTACCAGCCGAATCCTGAAGAGACACTACTACAACAAAATGGAACACAAGAAGAAAT
AAAATGTATGGATCAAATAAAGAAAATTGAAACAACTGGTTGCAACCAAGAAATAACATCATTTGAAATT
AATCTGAAGGAAAAAAAGTACCAGGAGGACTTTAACCCGCTGGTGAGAGGATGTTCCTGTTACTGCTGTA
AGAATCACACTCGGGCATACATCCACCATCTGCTGGTGACCAATGAGCTGCTGGCCGGAGTCCTGCTTAT
GATGCACAACTTTGAACACTACTTTGGGTTTTTCCATTACATCCGGGAAGCACTAAAAAGTGACAAACTG
GCACAGTTGAAAGAGCTCATCCACAGGCAAGCATCTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001256837
ORF Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256837.1, NP_001243766.1
RefSeq Size 3661
RefSeq ORF 879
Locus ID 79691
Gene Summary This gene encodes a subunit of tRNA-guanine transglycosylase. tRNA-guanine transglycosylase is a heterodimeric enzyme complex that plays a critical role in tRNA modification by synthesizing the 7-deazaguanosine queuosine, which is found in tRNAs that code for asparagine, aspartic acid, histidine, and tyrosine. The encoded protein may play a role in the queuosine 5'-monophosphate salvage pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (4) lacks two internal exons, uses an alternate splice site and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.