Triosephosphate isomerase (TPI1) (NM_001258026) Human Untagged Clone

CAT#: SC330629

TPI1 (untagged) - Homo sapiens triosephosphate isomerase 1 (TPI1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TPI1
• Synonyms: HEL-S-49; TIM; TPI; TPID
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001258026, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATCAAAGACTGCGGAGCCACGTGGGTGGTCCTGGGGCACTCAGAGAGAAGGCATGTCTTTGGGGAGT
  CAGATGAGCTGATTGGGCAGAAAGTGGCCCATGCTCTGGCAGAGGGACTCGGAGTAATCGCCTGCATTGG
  GGAGAAGCTAGATGAAAGGGAAGCTGGCATCACTGAGAAGGTTGTTTTCGAGCAGACAAAGGTCATCGCA
  GATAACGTGAAGGACTGGAGCAAGGTCGTCCTGGCCTATGAGCCTGTGTGGGCCATTGGTACTGGCAAGA
  CTGCAACACCCCAACAGGCCCAGGAAGTACACGAGAAGCTCCGAGGATGGCTGAAGTCCAACGTCTCTGA
  TGCGGTGGCTCAGAGCACCCGTATCATTTATGGAGGCTCTGTGACTGGGGCAACCTGCAAGGAGCTGGCC
  AGCCAGCCTGATGTGGATGGCTTCCTTGTGGGTGGTGCTTCCCTCAAGCCCGAATTCGTGGACATCATCA
  ATGCCAAACAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001258026
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001258026.1, NP_001244955.1
• RefSeq Size: 1602 bp
• RefSeq ORF: 504 bp
• Locus ID: 7167
• Cytogenetics: 12p13.31
• Protein Pathways: Fructose and mannose metabolism, Glycolysis / Gluconeogenesis, Inositol phosphate metabolism, Metabolic pathways
• Gene Summary: 'This gene encodes an enzyme, consisting of two identical proteins, which catalyzes the isomerization of glyceraldehydes 3-phosphate (G3P) and dihydroxy-acetone phosphate (DHAP) in glycolysis and gluconeogenesis. Mutations in this gene are associated with triosephosphate isomerase deficiency. Pseudogenes have been identified on chromosomes 1, 4, 6 and 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]'
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1.