HARS (NM_001258042) Human Untagged Clone
CAT#: SC330635
HARS (untagged) - Homo sapiens histidyl-tRNA synthetase (HARS), transcript variant 4
"NM_001258042" in other vectors (2)
Product Images
Other products for "HARS"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HARS |
Synonyms | CMT2W; HRS; USH3B |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001258042, the custom clone sequence may differ by one or more nucleotides
ATGGCAGAGCGTGCGGCGCTGGAGGAGCTGGTGAAACTTCAGGGAGAGCGCGTGCGAGGCCTCAAGCAGC AGAAGGCCAGCGCCGAGCTGATCGAGGAGGAGGTGGCGAAACTCCTGAAACTGAAGGCACAGCTGGGTCC TGATGAAAGCAAACAGAAATTTGTGCTCAAAACCCCCAAGGAAACACTGATGGGAAAGTATGGGGAAGAC TCCAAGCTTATCTATGACCTGAAGGACCAGGGCGGGGAGCTCCTGTCCCTTCGCTATGACCTCACTGTTC CTTTTGCTCGGTATTTGGCAATGAATAAACTGACCAACATTAAACGCTACCACATAGCAAAGGATTTTGA CATTGCTGGGAACTTTGATCCCATGATCCCTGATGCAGAGTGCCTGAAGATCATGTGCGAGATCCTGAGT TCACTTCAGATAGGCGACTTCCTGGTCAAGGTAAACGATCGACGCATTCTAGATGGGATGTTTGCTATCT GTGGTGTTTCTGACAGCAAGTTCCGTACCATCTGCTCCTCAGTAGACAAGCTGGACAAGGTGTCCTGGGA AGAGGTGAAGAATGAGATGGTGGGAGAGAAGGGCCTTGCACCTGAGGTGGCTGACCGCATTGGGGACTAT GTCCAGCAACATGGTGGGGTATCCCTGGTGGAACAGCTGCTCCAGGATCCTAAACTATCCCAAAACAAGC AGGCCTTGGAGGGCCTGGGAGACCTGAAGTTGCTCTTTGAGTACCTGACCCTATTTGGCATTGATGACAA AATCTCCTTTGACCTGAGCCTTGCTCGAGGGCTGGATTACTACACTGGGGTGATCTATGAGGCAGTGCTG CTACAGACCCCAGCCCAGGCAGGGGAAGAGCCCCTGGGTGTGGGCAGTGTGGCTGCTGGAGGACGCTATG ATGGGCTAGTGGGCATGTTCGACCCCAAAGGGCGCAAGGTGCCATGTGTGGGGCTCAGCATTGGGGTGGA GCGGATTTTCTCCATCGTGGAACAGAGACTAGAGGCTTTGGAGGAGAAGATACGGACCACGGAGACACAG GTGCTTGTGGCATCTGCACAGAAGAAGCTGCTAGAGGAAAGACTAAAGCTTGTCTCAGAACTGTGGGATG CTGGGATCAAGGCTGAGCTGCTGTACAAGAAGAACCCAAAGCTACTGAACCAGTTACAGTACTGTGAGGA GGCAGGCATCCCACTGGTGGCTATCATCGGCGAGCAGGAACTCAAGGATGGGGTCATCAAGCTCCGTTCA GTGACGAGCAGGGAAGAGGTGGATGTCCGAAGAGAAGACCTTGTGGAGGAAATCAAAAGGAGAACAGGCC AGCCCCTCTGCATCTGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001258042 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001258042.1, NP_001244971.1 |
RefSeq Size | 2142 bp |
RefSeq ORF | 2142 bp |
Locus ID | 3035 |
Cytogenetics | 5q31.3 |
Protein Pathways | Aminoacyl-tRNA biosynthesis |
Gene Summary | 'Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a cytoplasmic enzyme which belongs to the class II family of aminoacyl-tRNA synthetases. The enzyme is responsible for the synthesis of histidyl-transfer RNA, which is essential for the incorporation of histidine into proteins. The gene is located in a head-to-head orientation with HARSL on chromosome five, where the homologous genes share a bidirectional promoter. The gene product is a frequent target of autoantibodies in the human autoimmune disease polymyositis/dermatomyositis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]' Transcript Variant: This variant (4) lacks an alternate in-frame exon and uses an alternate in-frame splice junction at the 3' end of an exon compared to variant 1. The resulting isoform (4) has the same N- and C-termini but is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.