Inosine triphosphate pyrophosphatase (ITPA) (NM_001267623) Human Untagged Clone

CAT#: SC330776

ITPA (untagged) - Homo sapiens inosine triphosphatase (nucleoside triphosphate pyrophosphatase) (ITPA), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ITPA
• Synonyms: C20orf37; dJ794I6.3; HLC14-06-P; ITPase; My049; NTPase
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001267623, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCCTCATTGGTGGGGAAGAAGATCGTGTTTGTAACGGGGAACGCCAAGAAGCTGGAGGAGGTAC
  AGGGGCCCGTGCTGGTTGAGGACACTTGTCTGTGCTTCAATGCCCTTGGAGGGCTCCCCGGCCCCTACAT
  AAAGTGGTTTCTGGAGAAGTTAAAGCCTGAAGGTCTCCACCAGCTCCTGGCCGGGTTCGAGGACAAGTCA
  GCCTATGCGCTCTGCACGTTTGCACTCAGCACCGGGGACCCAAGCCAGCCCGTGCGCCTGTTCAGGGGCC
  GGACCTCGGGCCGGATCGTGGCACCCAGAGGCTGCCAGGACTTTGGCTGGGACCCCTGCTTTCAGCCTGA
  TGGATATGAGCAGACGTACGCAGAGATGCCTAAGGCGGAGAAGAACGCTGTCTCCCATCGCTTCCGGGCC
  CTGCTGGAGCTGCAGGAGTACTTTGGCAGTTTGGCAGCTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001267623
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001267623.1, NP_001254552.1
• RefSeq Size: 1079 bp
• RefSeq ORF: 462 bp
• Locus ID: 3704
• Cytogenetics: 20p13
• Protein Families: Druggable Genome
• Protein Pathways: Drug metabolism - other enzymes, Metabolic pathways, Purine metabolism, Pyrimidine metabolism
• Gene Summary: 'This gene encodes an inosine triphosphate pyrophosphohydrolase. The encoded protein hydrolyzes inosine triphosphate and deoxyinosine triphosphate to the monophosphate nucleotide and diphosphate. This protein, which is a member of the HAM1 NTPase protein family, is found in the cytoplasm and acts as a homodimer. Defects in the encoded protein can result in inosine triphosphate pyrophosphorylase deficiency which causes an accumulation of ITP in red blood cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]'
  Transcript Variant: This variant (3) lacks two in-frame exons in the coding region, compared to variant 1. The encoded isoform (c) is shorter than isoform 1.