RTBDN (NM_001270440) Human Untagged Clone

CAT#: SC330838

RTBDN (untagged) - Homo sapiens retbindin (RTBDN), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RTBDN
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270440, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACGAAGCCCTAGAAACGCAGCTGAAGACGAGCAGAGGACGCTTCTCGGCTACAGAATCCCTCCCCA
  CCTTGGAGCTCTTATCTCAGGTGGACATGGACTGCAGGGTCCACATGCGACCCATCGGCCTGACGTGGGT
  GCTGCAACTGACCTTGGCATGGATCCTGCTAGAAGCCTGTGGAGGGAGCCGCCCACTCCAAGCCAGGTCC
  CAGCAACACCATGGGCTGGCAGCTGATCTGGGCAAAGGCAAGCTGCACCTGGCAGGACCTTGTTGTCCCT
  CAGAGATGGACACAACAGAGACATCGGGCCCTGGAAACCATCCAGAACGCTGTGGAGTGCCGAGCCCTGA
  ATGCGAATCCTTCCTGGAACACCTCCAACGTGCCCTTCGCAGTCGCTTCCGCCTGCGGCTATTGGGGGTA
  CGCCAGGCACAGCCGCTCTGCGAGGAGCTCTGCCAGGCCTGGTTCGCCAACTGCGAAGATGATATCACCT
  GCGGCCCGACTTGGCTCCCACTCTCAGAAAAAAGGGGCTGTGAGCCCAGCTGCCTTACCTATGGACAGGC
  TGGAGTGCAGTGGCGCGATCTCAGCTCGATGCAACCTCCGCCTCCGGGGTTCAAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270440
• ORF Size: 618 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001270440.1, NP_001257369.1
• RefSeq Size: 2095
• RefSeq ORF: 618
• Locus ID: 83546
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: This gene was first identified in a study of human eye tissues. The protein encoded by this gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (3) has multiple differences in the UTRs and coding region, compared to variant 1. These differences cause translation initiation at an alternate start codon and result in an isoform (3) that is shorter and has distinct N- and C-termini, compared to isoform 1.