Bcl rambo (BCL2L13) (NM_001270734) Human Untagged Clone
CAT#: SC330873
BCL2L13 (untagged) - Homo sapiens BCL2-like 13 (apoptosis facilitator) (BCL2L13), transcript variant 10
"NM_001270734" in other vectors (2)
Product Images
Other products for "BCL2L13"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BCL2L13 |
Synonyms | BCL-RAMBO; Bcl2-L-13; MIL1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001270734, the custom clone sequence may differ by one or more nucleotides
ATGGCGTCCTCTTCTACTGTGCCTCTGGGATTTCACTATGAAACAAAGTATGTTGTTCTCAGCTACTTGG GACTCCTCTCTCAAGAGAAGCTGCAAGAGCAACATCTTTCCTCACCCCAAGGGGTTCAACTAGATATAGC TTCACAATCTCTGGATCAAGAAATTTTATTAAAAGTTAAAACTGAAATTGAAGAAGAGCTAAAATCTCTG GACAAAGAAATTTCTGAAGCCTTCACCAGCACAGGCTTTGACCGTCACACTTCTCCAGTGTTCAGCCCTG CCAATCCAGAAAGCTCAATGGAAGACTGCTTGGCCCATCTTGGAGAAAAAGTGTCCCAGGAACTGAAAGA GCCTCTCCATAAAGCATTGCAAATGCTCCTGAGCCAGGCACTGTGTTTAGTCTTGAGTCAGAGGAGGAGG AATACCCTGGAATCACTGCAGAAGATAGCAATGACATTTACATCCTGCCCAGCGACAACTCTGGACAAGT CAGTCCCCCAGAGTCTCCAACTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270734 |
ORF Size | 516 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001270734.1, NP_001257663.1 |
RefSeq Size | 4918 |
RefSeq ORF | 516 |
Locus ID | 23786 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a mitochondrially-localized protein with conserved B-cell lymphoma 2 homology motifs. Overexpression of the encoded protein results in apoptosis. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (10) lacks two alternate exons in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (h) is shorter and has a distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.