TRAPPC3 (NM_001270895) Human Untagged Clone

CAT#: SC330889

TRAPPC3 (untagged) - Homo sapiens trafficking protein particle complex 3 (TRAPPC3), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TRAPPC3
• Synonyms: BET3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270895, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCTTTAACATTGGAGTCCGGCTGATTGAAGATTTCTTGGCTCGGTCAAATGTTGGGAGGTGCCATG
  ACTTTCGGGAAACTGCGGATGTCATTGCCAAGGTGGCGTTCAAGATGTACTTGGGCATCACTCCAAGCAT
  TACTAATTGGAGCCCAGCTGGTGATGAATTCTCCCTCATTTTGGAAAATAACCCCTTGGTGGACTTTGTG
  GAACTTCCTGATAACCACTCATCCCTTATTTATTCCAATCTCTTGTGTGGGGTGTTGCGGGGAGCTTTGG
  AGATGGTCCAGATGGCTGTGGAGGCCAAGTTTGTCCAGGACACCCTGAAAGGAGACGGTGTGACAGAAAT
  CCGGATGAGATTCATCAGGCGGATTGAGGACAATCTTCCAGCTGGAGAGGAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270895
• ORF Size: 405 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001270895.1, NP_001257824.1
• RefSeq Size: 1326
• RefSeq ORF: 405
• Locus ID: 27095
• Gene Summary: This gene encodes a component of the trafficking protein particle complex, which tethers transport vesicles to the cis-Golgi membrane. The encoded protein participates in the regulation of transport from the endoplasmic reticulum to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an in-frame downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Variants 3 and 4 encode the same isoform (3).