DEFB119 (NM_001271209) Human Untagged Clone

CAT#: SC330931

DEFB119 (untagged) - Homo sapiens defensin, beta 119 (DEFB119), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DEFB119
• Synonyms: DEFB-19; DEFB-20; DEFB20; DEFB120; ESC42-RELA; ESC42-RELB
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271209, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAACTTCTTTACCTGTTTCTTGCCATCCTTCTGGCCATAGAAGAACCAGTGATATCAGAGTGTTGGA
  TGGATGGACACTGCCGGTTGTTGTGCAAAGATGGTGAAGACAGCATCATACGCTGCCGAAATCGTAAACG
  GTGCTGTGTTCCTAGTCGTTATTTAACAATCCAACCAGTAACAATTCATGGAATCCTTGGCTGGACCACT
  CCTCAGATGTCCACAACAGCTCCAAAAATGAAGACAAATATAACTAATAGATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271209
• ORF Size: 264 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271209.1, NP_001258138.1
• RefSeq Size: 510
• RefSeq ORF: 264
• Locus ID: 245932
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a member of the beta subfamily of defensins. Beta-defensins are antimicrobial peptides that protect tissues and organs from infection by a variety of microorganisms. This gene is found in a cluster with other beta-defensin genes on the long arm of chromosome 20. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
  Transcript Variant: This variant (4) uses an alternate in-frame splice site in the 3' exon, compared to variant 3. Then encoded isoform (d) is shorter than isoform c. Isoform d is thought to be an antimicrobial peptide.