Bcl rambo (BCL2L13) (NM_001270733) Human Untagged Clone

CAT#: SC331119

BCL2L13 (untagged) - Homo sapiens BCL2-like 13 (apoptosis facilitator) (BCL2L13), transcript variant 9

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BCL2L13
• Synonyms: BCL-RAMBO; Bcl2-L-13; MIL1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270733, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATCCTGAAGAAGTGAAAAGCTTAGACAGCAACGGAGCTGGAGAGAAGAGTGAGAACAACTCCTCTA
  ATTCTGACATTGTGCACGTGGAGAAAGAAGAGGTGCCCGAGGGCATGGAAGAGGCTGCTGTGGCTTCTGT
  GGTCTTGCCAGCGCGGGAGCTGCAAGAGGCACTTCCTGAAGCCCCAGCTCCCTTGCTTCCACATATCACT
  GCCACCTCCCTGCTGGGGACAAGGGAACCTGACACAGAAGTGATCACAGTTGAGAAATCCAGCCCTGCTA
  CATCTCTGTTTGTAGAACTTGATGAAGAAGAGGTGAAAGCAGCAACAACTGAACCTACTGAAGTGGAGGA
  GGTGGTCCCCGCACTGGAACCCACAGAAACGCTGCTGAGTGAGAAGGAGATAAACGCAAGGGAAGAGAGC
  CTTGTGGAAGAGCTGTCCCCTGCCAGCGAGAAGAAGCCCGTGCCGCCGTCTGAGGGCAAGTCTAGACTGT
  CCCCCGCCGGTGAGATGAAGCCCATGCCGCTGTCTGAGGGCAAGTCTATACTGCTGTTTGGAGGGGCTGC
  TGCTGTTGCCATCCTGGCAGTGGCCATCGGGGTAGCCCTGGCTCTGAGAAAGAAATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270733
• ORF Size: 618 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001270733.1, NP_001257662.1
• RefSeq Size: 4347
• RefSeq ORF: 618
• Locus ID: 23786
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a mitochondrially-localized protein with conserved B-cell lymphoma 2 homology motifs. Overexpression of the encoded protein results in apoptosis. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (9) lacks multiple exons in the 5' region but includes an alternate 5' exon, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (g) has a shorter N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.