TRAF1 (NM_001190945) Human Untagged Clone

CAT#: SC331145

TRAF1 (untagged) - Homo sapiens TNF receptor-associated factor 1 (TRAF1), transcript variant 2


  "NM_001190945" in other vectors (2)

Reconstitution Protocol

USD 420.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "TRAF1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TRAF1
Synonyms EBI6; MGC:10353
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001190945, the custom clone sequence may differ by one or more nucleotides


ATGGCCTCCAGCTCAGGCAGCAGTCCTCGCCCGGCCCCTGATGAGAATGAGTTTCCCTTTGGGTGCCCTC
CCACCGTCTGCCAGGACCCAAAGGAGCCCAGGGCTCTCTGCTGTGCAGGCTGTCTCTCTGAGAACCCGAG
GAATGGCGAGGATCAGATCTGCCCCAAATGCAGAGGGGAAGACCTCCAGTCTATAAGCCCAGGAAGCCGT
CTTCGAACTCAGGAGAAGGCTCACCCCGAGGTGGCTGAGGCTGGAATTGGGTGCCCCTTTGCAGGTGTCG
GCTGCTCCTTCAAGGGAAGCCCACAGTCTGTGCAAGAGCATGAGGTCACCTCCCAGACCTCCCACCTAAA
CCTGCTGTTGGGGTTCATGAAACAGTGGAAGGCCCGGCTGGGCTGTGGCCTGGAGTCTGGGCCCATGGCC
CTGGAGCAGAACCTGTCAGACCTGCAGCTGCAGGCAGCCGTGGAAGTGGCGGGGGACCTGGAGGTCGATT
GCTACCGGGCACCCTGCTCCGAGAGCCAGGAGGAGCTGGCCCTGCAGCACTTCATGAAGGAGAAGCTTCT
GGCTGAGCTGGAGGGGAAGCTGCGTGTGTTTGAGAACATTGTTGCTGTCCTCAACAAGGAGGTGGAGGCC
TCCCACCTGGCCCTGGCCACCTCTATCCACCAGAGCCAGCTGGACCGTGAGCGCATCCTGAGCTTGGAGC
AGAGGGTGGTGGAGCTTCAGCAGACCCTGGCCCAGAAAGACCAGGCCCTGGGCAAGCTGGAGCAGAGCTT
GCGCCTCATGGAGGAGGCCTCCTTCGATGGCACTTTCCTGTGGAAGATCACCAATGTCACCAGGCGGTGC
CATGAGTCGGCCTGTGGCAGGACCGTCAGCCTCTTCTCCCCAGCCTTCTACACTGCCAAGTATGGCTACA
AGTTGTGCCTGCGGCTGTACCTGAATGGAGATGGCACTGGAAAGAGAACCCATCTGTCGCTCTTCATCGT
GATCATGAGAGGGGAGTATGATGCGCTGCTGCCGTGGCCCTTCCGGAACAAGGTCACCTTCATGCTGCTG
GACCAGAACAACCGTGAGCACGCCATTGACGCCTTCCGGCCTGACCTAAGCTCAGCGTCCTTCCAGAGGC
CCCAGAGTGAAACCAACGTGGCCAGTGGATGCCCACTCTTCTTCCCCCTCAGCAAACTGCAGTCACCCAA
GCACGCCTACGTGAAGGACGACACAATGTTCCTCAAGTGCATTGTGGAGACCAGCACTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001190945
ORF Size 1251 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001190945.1, NP_001177874.1
RefSeq Size 4303
RefSeq ORF 1251
Locus ID 7185
Protein Families Druggable Genome
Protein Pathways Pathways in cancer, Small cell lung cancer
Gene Summary The protein encoded by this gene is a member of the TNF receptor (TNFR) associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from various receptors of the TNFR superfamily. This protein and TRAF2 form a heterodimeric complex, which is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF2 also interacts with inhibitor-of-apoptosis proteins (IAPs), and thus mediates the anti-apoptotic signals from TNF receptors. The expression of this protein can be induced by Epstein-Barr virus (EBV). EBV infection membrane protein 1 (LMP1) is found to interact with this and other TRAF proteins; this interaction is thought to link LMP1-mediated B lymphocyte transformation to the signal transduction from TNFR family receptors. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Transcript Variant: This variant (2) differs in the 5' UTR compared to isoform 1. Variants 1 and 2 both encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.