MLC1SA (MYL6B) (NM_001199629) Human Untagged Clone

CAT#: SC331332

MYL6B (untagged) - Homo sapiens myosin, light chain 6B, alkali, smooth muscle and non-muscle (MYL6B), transcript variant 1


  "NM_001199629" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MYL6B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MYL6B
Synonyms MLC1SA
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001199629, the custom clone sequence may differ by one or more nucleotides


ATGCCTCCCAAGAAGGATGTTCCCGTGAAGAAACCAGCAGGGCCCTCCATCTCCAAACCTGCTGCTAAGC
CAGCAGCAGCAGGGGCTCCTCCAGCCAAGACCAAAGCTGAGCCAGCTGTCCCCCAGGCCCCTCAGAAAAC
CCAGGAGCCTCCAGTCGATCTCTCCAAAGTGGTGATCGAGTTTAACAAGGACCAGCTGGAGGAGTTCAAG
GAGGCCTTCGAGCTGTTTGACCGAGTGGGGGATGGCAAGATCCTGTACAGCCAGTGTGGGGACGTGATGA
GGGCCCTGGGCCAGAACCCCACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGCT
GAAGTCGCGGCGTGTGGACTTTGAGACTTTCCTGCCCATGCTCCAGGCAGTGGCCAAGAACCGAGGCCAA
GGCACATATGAGGACTACTTGGAGGGGTTTCGTGTGTTTGACAAGGAGGGGAACGGCAAAGTCATGGGAG
CAGAGCTCAGACATGTTCTCACCACCCTTGGAGAGAAGATGACTGAGGAGGAGGTGGAGACCGTTCTGGC
AGGACACGAGGACAGCAACGGCTGCATCAACTACGAGGCCTTCTTGAAACACATCCTAAGCGTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001199629
ORF Size 627 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001199629.1, NP_001186558.1
RefSeq Size 1072
RefSeq ORF 627
Locus ID 140465
Protein Pathways Vascular smooth muscle contraction
Gene Summary Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain expressed in both slow-twitch skeletal muscle and in nonmuscle tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.