PMF1-BGLAP (NM_001199661) Human Untagged Clone

CAT#: SC331339

PMF1 (untagged) - Homo sapiens PMF1-BGLAP readthrough (PMF1-BGLAP), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PMF1-BGLAP
• Synonyms: PMF-1; PMF1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199661, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCGAAGCAAGTAGCGCCAATCTAGGCAGCGGCTGTGAGGAAAAAAGGCATGAGGGGTCGTCTTCGG
  AATCTGTGCCACCCGGCACTACCATTTCGAGGGTGAAGCTCCTCGACACCATGGTGGACACTTTTCTTCA
  GAAGCTGGTCGCCGCCGGCAGCTACCAGAGATTCACTGACTGCTATAAGTGCTTCTACCAGTTGCAGCCT
  GCGATGACACAGCAAATCTATGACAAGTTTATAGCTCAGTTGCAGACATCTATCCGGGAGGAAATCTCTG
  ACATCAAAGAGGAGGGGAACCTAGAAGCTGTCTTGAATGCCTTGGATAAAATTGTGGAAGAAGGCAAAGT
  CCGCAAAGAGCCAGCCTGCAACGGGACACCCTGCGGCGCCATGTGCAGAAACAGGAGGCCGAGAACCAGC
  AGCTGGCAGATGCCGTCCTGGCAGGGCGGAGGCAGGTGGAGGAGCTGCAGCTACAGGTCCAGGCCCAGCA
  GCAGGCCTGGCAGGTGCGAAGCCCAGCGGTGCAGAGTCCAGCAAAGGTGCAGCCTTTGTGTCCAAGCAGG
  AGGGCAGCGAGGTAGTGAAGAGACCCAGGCGCTACCTGTATCAATGGCTGGGAGCCCCAGTCCCCTACCC
  GGATCCCCTGGAGCCCAGGAGGGAGGTGTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199661
• ORF Size: 663 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001199661.1, NP_001186590.1
• RefSeq Size: 940
• RefSeq ORF: 663
• Locus ID: 100527963
• Gene Summary: This locus represents naturally occurring read-through transcription between the neighboring PMF1 (polyamine-modulated factor 1) and BGLAP (bone gamma-carboxyglutamate Gla protein) genes on chromosome 1. Alternative splicing results in multiple transcript variants encoding isoforms that share sequence identity with the upstream gene product, but they contain distinct C-termini due to frameshifts versus the downstream gene coding sequence. [provided by RefSeq, Dec 2010]
  Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.