SNX10 (NM_001199837) Human Untagged Clone

CAT#: SC331377

SNX10 (untagged) - Homo sapiens sorting nexin 10 (SNX10), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SNX10
• Synonyms: OPTB8
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199837, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATGCCATTACAGGAATTTGTAAGTGTCTGGGTTCGAGATCCTAGGATTCAGAAGGAGGACTTCTGGC
  ATTCTTACATTGACTATGAGATATGTATTCATACTAATAGCATGTGTTTTACAATGAAAACATCCTGTGT
  ACGAAGAAGATATAGAGAATTCGTGTGGCTGAGGCAGAGACTCCAAAGTAATGCGTTGCTGGTACAACTG
  CCAGAACTTCCATCTAAAAACCTGTTTTTCAACATGAACAATCGCCAGCACGTGGATCAGCGTCGCCAGG
  GTCTGGAAGATTTCCTCAGAAAAGTCCTACAGAATGCACTTTTGCTTTCAGATAGCAGCCTTCACCTCTT
  CTTACAGAGCCATCTGAATTCAGAAGACATTGAGGCGTGTGTTTCTGGGCAGACTAAGTACTCTGTGGAA
  GAAGCAATTCACAAGTTTGCCTTAATGAATAGACGTTTCCCTGAAGAAGATGAAGAAGGAAAAAAAGAAA
  ATGATATAGATTATGATTCAGAAAGTTCATCCTCTGGGCTTGGACACAGTAGTGATGACAGCAGTTCACA
  TGGATGTAAAGTAAATACAGCTCCGCAGGAATCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199837
• ORF Size: 597 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001199837.1, NP_001186766.1
• RefSeq Size: 2443
• RefSeq ORF: 597
• Locus ID: 29887
• Gene Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. This gene may play a role in regulating endosome homeostasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
  Transcript Variant: This variant (3) has a distinct 5' UTR, compared to variant 1, which results in the use of a distinct translation initiation signal. It encodes a shorter isoform (2) with a distinct N-terminus, compared to isoform 1.