CLEC12A (NM_001207010) Human Untagged Clone

CAT#: SC331733

CLEC12A (untagged) - Homo sapiens C-type lectin domain family 12, member A (CLEC12A), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLEC12A
• Synonyms: CD371; CLL-1; CLL1; DCAL-2; MICL
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001207010, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTGGATAGATTTCTTTACATATTCATCAATGTCTGAAGAAGTTACTTATGCAGATCTTCAATTCCAGA
  ACTCCAGTGAGATGGAAAAAATCCCAGAAATTGGCAAATTTGGGGAAAAAGCACCTCCAGCTCCCTCTCA
  TGTATGGCGTCCAGCAGCCTTGTTTCTGACTCTTCTGTGCCTTCTGTTGCTCATTGGATTGGGAGTCTTG
  GCAAGCATGTTTCACGTAACTTTGAAGATAGAAATGAAAAAAATGAACAAACTACAAAACATCAGTGAAG
  AGCTCCAGAGAAATATTTCTCTACAACTGATGAGTAACATGAATATCTCCAACAAGATCAGGAACCTCTC
  CACCACACTGCAAACAATAGCCACCAAATTATGTCGTGAGCTATATAGCAAAGAACAAGAGCACAAATGT
  AAGCCTTGTCCAAGGAGATGGATTTGGCATAAGGACAGCTGTTATTTCCTAAGTGATGATGTCCAAACAT
  GGCAGGAGAGTAAAATGGCCTGTGCTGCTCAGAATGCCAGCCTGTTGAAGATAAACAACAAAAATGCATT
  GGAATTTATAAAATCCCAGAGTAGATCATATGACTATTGGCTGGGATTATCTCCTGAAGAAGATTCCACT
  CGTGGTATGAGAGTGGATAATATAATCAACTCCTCTGCCTGGGTTATAAGAAACGCACCTGACTTAAATA
  ACATGTATTGTGGATATATAAATAGACTATATGTTCAATATTATCACTGCACTTATAAAAAAAGAATGAT
  ATGTGAGAAGATGGCCAATCCAGTGCAGCTTGGTTCTACATATTTTAGGGAGGCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001207010
• ORF Size: 828 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001207010.1, NP_001193939.1
• RefSeq Size: 1492
• RefSeq ORF: 828
• Locus ID: 160364
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. The protein encoded by this gene is a negative regulator of granulocyte and monocyte function. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. This gene is closely linked to other CTL/CTLD superfamily members in the natural killer gene complex region on chromosome 12p13. [provided by RefSeq, May 2011]
  Transcript Variant: This variant (3) differs in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. This variant encodes isoform 3, which has a longer N-terminus, compared to isoform 1.