Rad9 (RAD9A) (NM_001243224) Human Untagged Clone

CAT#: SC331971

RAD9A (untagged) - Homo sapiens RAD9 homolog A (S. pombe) (RAD9A), transcript variant 2


  "NM_001243224" in other vectors (2)

Reconstitution Protocol

USD 320.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RAD9A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAD9A
Synonyms RAD9
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001243224, the custom clone sequence may differ by one or more nucleotides


ATGCAGTCTTTCCTGTCTGTCTTCCGCTCACTGGCGATGCTGGAGAAGACGGTGGAAAAATGCTGCATCT
CCCTGAATGGCCGGAGCAGCCGCCTGGTGGTCCAGCTGCATTGCAAGTTCGGGGTGCGGAAGACTCACAA
CCTGTCCTTCCAGGACTGTGAGTCCCTGCAGGCCGTCTTCGACCCAGCCTCGTGCCCCCACATGCTCCGC
GCCCCAGCACGGGTTCTGGGGGAGGCTGTTCTGCCCTTCTCTCCTGCACTGGCTGAAGTGACGCTGGGCA
TTGGCCGTGGCCGCAGGGTCATCCTGCGCAGCTACCACGAGGAGGAGGCAGACAGCACTGCCAAAGCCAT
GGTGACTGAGATGTGCCTTGGAGAGGAGGATTTCCAGCAGCTGCAGGCCCAGGAAGGGGTGGCCATCACT
TTCTGCCTCAAGGAATTCCGGGGGCTCCTGAGCTTTGCAGAGTCAGCAAACTTGAATCTTAGCATTCATT
TTGATGCTCCAGGCAGGCCCGCCATCTTCACCATCAAGGACTCTTTGCTGGACGGCCACTTTGTCTTGGC
CACACTCTCAGACACCGACTCGCACTCCCAGGACCTGGGCTCCCCAGAGCGTCACCAGCCAGTGCCTCAG
CTCCAGGCTCACAGCACACCCCACCCGGACGACTTTGCCAATGACGACATTGACTCTTACATGATCGCCA
TGGAAACCACTATAGGCAATGAGGGCTCGCGGGTGCTGCCCTCCATTTCCCTTTCACCTGGCCCCCAGCC
CCCCAAGAGCCCCGGTCCCCACTCCGAGGAGGAAGATGAGGCTGAGCCCAGTACAGTGCCTGGGACTCCC
CCACCCAAGAAGTTCCGCTCACTGTTCTTCGGCTCCATCCTGGCCCCTGTACGCTCCCCCCAGGGCCCCA
GCCCTGTGCTGGCGGAAGACAGTGAGGGTGAAGGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001243224
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243224.1, NP_001230153.1
RefSeq Size 1992 bp
RefSeq ORF 948 bp
Locus ID 5883
Cytogenetics 11q13.2
Protein Families Druggable Genome, Stem cell - Pluripotency
Gene Summary 'This gene product is highly similar to Schizosaccharomyces pombe rad9, a cell cycle checkpoint protein required for cell cycle arrest and DNA damage repair. This protein possesses 3' to 5' exonuclease activity, which may contribute to its role in sensing and repairing DNA damage. It forms a checkpoint protein complex with RAD1 and HUS1. This complex is recruited by checkpoint protein RAD17 to the sites of DNA damage, which is thought to be important for triggering the checkpoint-signaling cascade. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]'
Transcript Variant: This variant (2) contains an alternate 5' terminal exon (with an in-frame AUG) compared to variant 1. This results in a a shorter isoform (2) with a distinct N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.