Rad9 (RAD9A) (NM_001243224) Human Untagged Clone
CAT#: SC331971
RAD9A (untagged) - Homo sapiens RAD9 homolog A (S. pombe) (RAD9A), transcript variant 2
"NM_001243224" in other vectors (2)
Product Images
Other products for "RAD9A"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RAD9A |
Synonyms | RAD9 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243224, the custom clone sequence may differ by one or more nucleotides
ATGCAGTCTTTCCTGTCTGTCTTCCGCTCACTGGCGATGCTGGAGAAGACGGTGGAAAAATGCTGCATCT CCCTGAATGGCCGGAGCAGCCGCCTGGTGGTCCAGCTGCATTGCAAGTTCGGGGTGCGGAAGACTCACAA CCTGTCCTTCCAGGACTGTGAGTCCCTGCAGGCCGTCTTCGACCCAGCCTCGTGCCCCCACATGCTCCGC GCCCCAGCACGGGTTCTGGGGGAGGCTGTTCTGCCCTTCTCTCCTGCACTGGCTGAAGTGACGCTGGGCA TTGGCCGTGGCCGCAGGGTCATCCTGCGCAGCTACCACGAGGAGGAGGCAGACAGCACTGCCAAAGCCAT GGTGACTGAGATGTGCCTTGGAGAGGAGGATTTCCAGCAGCTGCAGGCCCAGGAAGGGGTGGCCATCACT TTCTGCCTCAAGGAATTCCGGGGGCTCCTGAGCTTTGCAGAGTCAGCAAACTTGAATCTTAGCATTCATT TTGATGCTCCAGGCAGGCCCGCCATCTTCACCATCAAGGACTCTTTGCTGGACGGCCACTTTGTCTTGGC CACACTCTCAGACACCGACTCGCACTCCCAGGACCTGGGCTCCCCAGAGCGTCACCAGCCAGTGCCTCAG CTCCAGGCTCACAGCACACCCCACCCGGACGACTTTGCCAATGACGACATTGACTCTTACATGATCGCCA TGGAAACCACTATAGGCAATGAGGGCTCGCGGGTGCTGCCCTCCATTTCCCTTTCACCTGGCCCCCAGCC CCCCAAGAGCCCCGGTCCCCACTCCGAGGAGGAAGATGAGGCTGAGCCCAGTACAGTGCCTGGGACTCCC CCACCCAAGAAGTTCCGCTCACTGTTCTTCGGCTCCATCCTGGCCCCTGTACGCTCCCCCCAGGGCCCCA GCCCTGTGCTGGCGGAAGACAGTGAGGGTGAAGGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243224 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001243224.1, NP_001230153.1 |
RefSeq Size | 1992 bp |
RefSeq ORF | 948 bp |
Locus ID | 5883 |
Cytogenetics | 11q13.2 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Gene Summary | 'This gene product is highly similar to Schizosaccharomyces pombe rad9, a cell cycle checkpoint protein required for cell cycle arrest and DNA damage repair. This protein possesses 3' to 5' exonuclease activity, which may contribute to its role in sensing and repairing DNA damage. It forms a checkpoint protein complex with RAD1 and HUS1. This complex is recruited by checkpoint protein RAD17 to the sites of DNA damage, which is thought to be important for triggering the checkpoint-signaling cascade. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]' Transcript Variant: This variant (2) contains an alternate 5' terminal exon (with an in-frame AUG) compared to variant 1. This results in a a shorter isoform (2) with a distinct N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.