MEST (NM_001253900) Human Untagged Clone

CAT#: SC332250

MEST (untagged) - Homo sapiens mesoderm specific transcript (MEST), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MEST
• Synonyms: PEG1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001253900, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGCGCCGAGATCGCCTCCGCAGGATGAGGGAGTGGTGGGTCCAGGTGGGGCTGCTGGCCGTGCCCC
  TGCTTGCTGCGTACCTGCACATCCCACCCCCTCAGCTCTCCCCTGCCCTTCACTCATGGAAGTCTTCAGA
  CTCTGTGGGTGTGGTTGGAAGTCCAGAGATAGTTGTGCTTTTACACGGTTTTCCAACATCCAGCTACGAC
  TGGTACAAGATTTGGGAAGGTCTGACCTTGAGGTTTCATCGGGTGATTGCCCTTGATTTCTTAGGCTTTG
  GCTTCAGTGACAAACCGAGACCACATCACTATTCCATATTTGAGCAGGCCAGCATCGTGGAAGCGCTTTT
  GCGGCATCTGGGGCTCCAGAACCGCAGGATCAACCTTCTTTCTCATGACTATGGAGATATTGTTGCTCAG
  GAGCTTCTCTACAGGTACAAGCAGAATCGATCTGGTCGGCTTACCATAAAGAGTCTCTGTCTGTCAAATG
  GAGGTATCTTTCCTGAGACTCACCGTCCACTCCTTCTCCAAAAGCTACTCAAAGATGGAGGTGTGCTGTC
  ACCCATCCTCACACGACTGATGAACTTCTTTGTATTCTCTCGAGGTCTCACCCCAGTCTTTGGGCCGTAT
  ACTCGGCCCTCTGAGAGTGAGCTGTGGGACATGTGGGCAGGGATCCGCAACAATGACGGGAACTTAGTCA
  TTGACAGTCTCTTACAGTACATCAATCAGAGGAAGAAGTTCAGAAGGCGCTGGGTGGGAGCTCTTGCCTC
  TGTAACTATCCCCATTCATTTTATCTATGGGCCATTGGATCCTGTAAATCCCTATCCAGAGTTTTTGGAG
  CTGTACAGGAAAACGCTGCCGCGGTCCACAGTGTCGATTCTGGATGACCACATTAGCCACTATCCACAGC
  TAGAGGATCCCATGGGCTTCTTGAATGCATATATGGGCTTCATCAACTCCTTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001253900
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001253900.1, NP_001240829.1
• RefSeq Size: 2471 bp
• RefSeq ORF: 966 bp
• Locus ID: 4232
• Cytogenetics: 7q32.2
• Protein Families: Protease, Transmembrane
• Gene Summary: 'This gene encodes a member of the alpha/beta hydrolase superfamily. It is imprinted, exhibiting preferential expression from the paternal allele in fetal tissues, and isoform-specific imprinting in lymphocytes. The loss of imprinting of this gene has been linked to certain types of cancer and may be due to promotor switching. The encoded protein may play a role in development. Alternatively spliced transcript variants encoding multiple isoforms have been identified for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3 and 4, and the long arm of chromosomes 6 and 15. [provided by RefSeq, Dec 2011]'
  Transcript Variant: This variant (4) uses an alternate splice site in the 5' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (c) is shorter than isoform a.