MEST (NM_001253902) Human Untagged Clone
CAT#: SC332252
MEST (untagged) - Homo sapiens mesoderm specific transcript (MEST), transcript variant 6
"NM_001253902" in other vectors (2)
Product Images
Other products for "MEST"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MEST |
Synonyms | PEG1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001253902, the custom clone sequence may differ by one or more nucleotides
ATGAGGGAGTGGTGGGTCCAGGTGGGGCTGCTGGCCGTGCCCCTGCTTGCTGCGTACCTGCACATCCCAC CCCCTCAGCTCTCCCCTGCCCTTCACTCATGGAAGTCTTCAGGCAAGTTTTTCACTTACAAGGGACTGCG TATCTTCTACCAAGACTCTGTGGGTGTGGTTGGAAGTCCAGAGATAGTTGTGCTTTTACACGGTTTTCCA ACATCCAGCTACGACTGGTACAAGATTTGGGAAGGTCTGACCTTGAGGTTTCATCGGGTGATTGCCCTTG ATTTCTTAGGCTTTGGCTTCAGTGACAAACCGAGACCACATCACTATTCCATATTTGAGCAGGCCAGCAT CGTGGAAGCGCTTTTGCGGCATCTGGGGCTCCAGAACCGCAGGATCAACCTTCTTTCTCATGACTATGGA GATATTGTTGCTCAGGAGCTTCTCTACAGGTACAAGCAGAATCGATCTGGTCGGCTTACCATAAAGAGTC TCTGTCTGTCAAATGGAGGTATCTTTCCTGAGACTCACCGTCCACTCCTTCTCCAAAAGCTACTCAAAGA TGGAGGTGTGCTGTCACCCATCCTCACACGACTGATGAACTTCTTTGTATTCTCTCGAGGTCTCTTACAG TACATCAATCAGAGGAAGAAGTTCAGAAGGCGCTGGGTGGGAGCTCTTGCCTCTGTAACTATCCCCATTC ATTTTATCTATGGGCCATTGGATCCTGTAAATCCCTATCCAGAGTTTTTGGAGCTGTACAGGAAAACGCT GCCGCGGTCCACAGTGTCGATTCTGGATGACCACATTAGCCACTATCCACAGCTAGAGGATCCCATGGGC TTCTTGAATGCATATATGGGCTTCATCAACTCCTTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001253902 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001253902.1, NP_001240831.1 |
RefSeq Size | 2302 bp |
RefSeq ORF | 879 bp |
Locus ID | 4232 |
Cytogenetics | 7q32.2 |
Protein Families | Protease, Transmembrane |
Gene Summary | 'This gene encodes a member of the alpha/beta hydrolase superfamily. It is imprinted, exhibiting preferential expression from the paternal allele in fetal tissues, and isoform-specific imprinting in lymphocytes. The loss of imprinting of this gene has been linked to certain types of cancer and may be due to promotor switching. The encoded protein may play a role in development. Alternatively spliced transcript variants encoding multiple isoforms have been identified for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3 and 4, and the long arm of chromosomes 6 and 15. [provided by RefSeq, Dec 2011]' Transcript Variant: This variant (6) differs in the 5' UTR, lacks an exon in the coding region and uses a downstream, in-frame start codon, compared to variant 1. Variants 5 and 6 encode the same isoform (d), which is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.