DDX19B (NM_001257173) Human Untagged Clone

CAT#: SC332513

DDX19B (untagged) - Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B (DDX19B), transcript variant 5


  "NM_001257173" in other vectors (2)

Reconstitution Protocol

USD 370.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "DDX19B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DDX19B
Synonyms DBP5; DDX19; RNAh
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001257173, the custom clone sequence may differ by one or more nucleotides


ATGGGTTTCAATCGTCCATCCAAGATACAAGAGAACGCATTGCCACTGATGCTTGCTGAGCCCCCACAGA
ACTTAATTGCCCAATCTCAGTCTGGTACTGGTAAAACAGCTGCCTTCGTGCTGGCCATGCTTAGCCAAGT
AGAACCTGCAAACAAATACCCCCAGTGTCTATGTCTCTCCCCAACGTATGAGCTCGCCCTCCAAACAGGA
AAAGTGATTGAACAAATGGGCAAATTTTACCCTGAACTGAAGCTAGCTTATGCTGTTCGAGGCAATAAAT
TGGAAAGAGGCCAGAAGATCAGTGAGCAGATTGTCATTGGCACCCCTGGGACTGTGCTGGACTGGTGCTC
CAAGCTCAAGTTCATTGATCCCAAGAAAATCAAGGTGTTTGTTCTGGATGAGGCTGATGTCATGATAGCC
ACTCAGGGCCACCAAGATCAGAGCATCCGCATCCAGAGGATGCTGCCCAGGAACTGCCAGATGCTGCTTT
TCTCCGCCACCTTTGAAGACTCTGTGTGGAAGTTTGCCCAGAAAGTGGTCCCAGACCCAAACGTTATCAA
ACTGAAGCGTGAGGAAGAGACCCTGGACACCATCAAGCAGTACTATGTCCTGTGCAGCAGCAGAGACGAG
AAGTTCCAGGCCTTGTGTAACCTCTACGGGGCCATCACCATTGCTCAAGCCATGATCTTCTGCCATACTC
GCAAAACAGCTAGTTGGCTGGCAGCAGAGCTCTCAAAAGAAGGCCACCAGGTGGCTCTGCTGAGTGGGGA
GATGATGGTGGAACAGAGGGCTGCAGTGATTGAGCGCTTCCGAGAGGGCAAAGAGAAGGTTTTGGTGACC
ACCAACGTGTGTGCCCGCGGCATTGATGTTGAACAAGTGTCTGTCGTCATCAACTTTGATCTTCCCGTGG
ACAAGGACGGGAATCCTGACAATGAGACCTACCTGCACCGGATCGGGCGCACGGGCCGCTTTGGCAAGAG
GGGCCTGGCAGTGAACATGGTGGACAGCAAGCACAGCATGAACATCCTGAACAGAATCCAGGAGCATTTT
AATAAGAAGATAGAAAGATTGGACACAGATGATTTGGACGAGATTGAGAAAATAGCCAACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001257173
ORF Size 1113 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001257173.1, NP_001244102.1
RefSeq Size 1818
RefSeq ORF 1113
Locus ID 11269
Gene Summary DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which exhibits RNA-dependent ATPase and ATP-dependent RNA-unwinding activities. This protein is recruited to the cytoplasmic fibrils of the nuclear pore complex, where it participates in the export of mRNA from the nucleus. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an downstream start codon, compared to variant 1. Variants 3, 5 and 6 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.