AMCase (CHIA) (NM_001258002) Human Untagged Clone

CAT#: SC332562

CHIA (untagged) - Homo sapiens chitinase, acidic (CHIA), transcript variant 6


  "NM_001258002" in other vectors (2)

Reconstitution Protocol

USD 320.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CHIA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CHIA
Synonyms AMCASE; CHIT2; TSA1902
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001258002, the custom clone sequence may differ by one or more nucleotides


ATGCGTGAAGCTTTTGAGCAGGAGGCCAAGCAGATCAACAAGCCCAGGCTGATGGTCACTGCTGCAGTAG
CTGCTGGCATCTCCAATATCCAGTCTGGCTATGAGATCCCCCAACTGTCACAGTACCTGGACTACATCCA
TGTCATGACCTACGACCTCCATGGCTCCTGGGAGGGCTACACTGGAGAGAACAGCCCCCTCTACAAATAC
CCGACTGACACCGGCAGCAACGCCTACCTCAATGTGGATTATGTCATGAACTACTGGAAGGACAATGGAG
CACCAGCTGAGAAGCTCATCGTTGGATTCCCTACCTATGGACACAACTTCATCCTGAGCAACCCCTCCAA
CACTGGAATTGGTGCCCCCACCTCTGGTGCTGGTCCTGCTGGGCCCTATGCCAAGGAGTCTGGGATCTGG
GCTTACTACGAGATCTGTACCTTCCTGAAAAATGGAGCCACTCAGGGATGGGATGCCCCTCAGGAAGTGC
CTTATGCCTATCAGGGCAATGTGTGGGTTGGCTATGACAACATCAAGAGCTTCGATATTAAGGCTCAATG
GCTTAAGCACAACAAATTTGGAGGCGCCATGGTCTGGGCCATTGATCTGGATGACTTCACTGGCACTTTC
TGCAACCAGGGCAAGTTTCCCCTAATCTCCACCCTGAAGAAGGCCCTCGGCCTGCAGAGTGCAAGTTGCA
CGGCTCCAGCTCAGCCCATTGAGCCAATAACTGCTGCTCCCAGTGGCAGCGGGAACGGGAGCGGGAGTAG
CAGCTCTGGAGGCAGCTCGGGAGGCAGTGGATTCTGTGCTGTCAGAGCCAACGGCCTCTACCCCGTGGCA
AATAACAGAAATGCCTTCTGGCACTGCGTGAATGGAGTCACGTACCAGCAGAACTGCCAGGCCGGGCTTG
TCTTCGACACCAGCTGTGATTGCTGCAACTGGGCATAA


Restriction Sites SgfI-MluI     
ACCN NM_001258002
ORF Size 948 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001258002.1, NP_001244931.1
RefSeq Size 1248
RefSeq ORF 948
Locus ID 27159
Protein Families Secreted Protein
Protein Pathways Amino sugar and nucleotide sugar metabolism
Gene Summary The protein encoded by this gene degrades chitin, which is found in the cell wall of most fungi as well as in arthropods and some nematodes. The encoded protein can also stimulate interleukin 13 expression, and variations in this gene can lead to asthma susceptibility. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (6) lacks exons in the 5' coding region and initiates translation at a downstream AUG compared to variant 4. The encoded isoform (b, also known as TSA1902-S) has a shorter N-terminus and lacks a signal peptide compared to isoform c. Variants 3, 6, 8, and 9 all encode the same isoform (b).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.