FLI1 (NM_001271010) Human Untagged Clone
CAT#: SC333024
FLI1 (untagged) - Homo sapiens Fli-1 proto-oncogene, ETS transcription factor (FLI1), transcript variant 3
"NM_001271010" in other vectors (2)
Product Images
Other products for "FLI1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FLI1 |
Synonyms | BDPLT21; EWSR2; SIC-1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001271010, the custom clone sequence may differ by one or more nucleotides
ATGGAGGGAGGACTGGCAGGCGAGCGGGCGAGGGAGTCTCCGGTGGACTGCAGCGTTAGCAAATGCAGCA AGCTGGTGGGCGGAGGCGAGTCCAACCCCATGAACTACAACAGCTATATGGACGAGAAGAATGGCCCCCC TCCTCCCAACATGACCACCAACGAGAGGAGAGTCATCGTCCCCGCAGACCCCACACTGTGGACACAGGAG CATGTGAGGCAATGGCTGGAGTGGGCCATAAAGGAGTACAGCTTGATGGAGATCGACACATCCTTTTTCC AGAACATGGATGGCAAGGAACTGTGTAAAATGAACAAGGAGGACTTCCTCCGCGCCACCACCCTCTACAA CACGGAAGTGCTGTTGTCACACCTCAGTTACCTCAGGGAAAGTTCACTGCTGGCCTATAATACAACCTCC CACACCGACCAATCCTCACGATTGAGTGTCAAAGAAGACCCTTCTTATGACTCAGTCAGAAGAGGAGCTT GGGGCAATAACATGAATTCTGGCCTCAACAAAAGTCCTCCCCTTGGAGGGGCACAAACGATCAGTAAGAA TACAGAGCAACGGCCCCAGCCAGATCCGTATCAGATCCTGGGCCCGACCAGCAGTCGCCTAGCCAACCCT GGAAGCGGGCAGATCCAGCTGTGGCAATTCCTCCTGGAGCTGCTCTCCGACAGCGCCAACGCCAGCTGTA TCACCTGGGAGGGGACCAACGGGGAGTTCAAAATGACGGACCCCGATGAGGTGGCCAGGCGCTGGGGCGA GCGGAAAAGCAAGCCCAACATGAATTACGACAAGCTGAGCCGGGCCCTCCGTTATTACTATGATAAAAAC ATTATGACCAAAGTGCACGGCAAAAGATATGCTTACAAATTTGACTTCCACGGCATTGCCCAGGCTCTGC AGCCACATCCGACCGAGTCGTCCATGTACAAGTACCCTTCTGACATCTCCTACATGCCTTCCTACCATGC CCACCAGCAGAAGGTGAACTTTGTCCCTCCCCATCCATCCTCCATGCCTGTCACTTCCTCCAGCTTCTTT GGAGCCGCATCACAATACTGGACCTCCCCCACGGGGGGAATCTACCCCAACCCCAACGTCCCCCGCCATC CTAACACCCACGTGCCTTCACACTTAGGCAGCTACTACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271010 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001271010.1, NP_001257939.1 |
RefSeq Size | 4166 bp |
RefSeq ORF | 1161 bp |
Locus ID | 2313 |
Cytogenetics | 11q24.3 |
Protein Families | Transcription Factors |
Gene Summary | 'This gene encodes a transcription factor containing an ETS DNA-binding domain. The gene can undergo a t(11;22)(q24;q12) translocation with the Ewing sarcoma gene on chromosome 22, which results in a fusion gene that is present in the majority of Ewing sarcoma cases. An acute lymphoblastic leukemia-associated t(4;11)(q21;q23) translocation involving this gene has also been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]' Transcript Variant: This variant (3) contains a distinct 5' UTR and 5' coding region, and uses an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct and shorter N-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.