Cardiac Troponin T (TNNT2) (NM_001276347) Human Untagged Clone

CAT#: SC333246

TNNT2 (untagged) - Homo sapiens troponin T type 2 (cardiac) (TNNT2), transcript variant 7

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TNNT2
• Synonyms: CMD1D; CMH2; CMPD2; cTnT; LVNC6; RCM3; TnTC
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001276347, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTGACATAGAAGAGGTGGTGGAAGAGTACGAGGAGGAGGAGCAGGAAGAAGCAGCTGTTGAAGAGC
  AGGAGGAGGCAGCGGAAGAGGATGCTGAAGCAGAGGCTGAGACCGAGGAGACCAGGGCAGAAGAAGATGA
  AGAAGAAGAGGAAGCAAAGGAGGCTGAAGATGGCCCAATGGAGGAGTCCAAACCAAAGCCCAGGTCGTTC
  ATGCCCAACTTGGTGCCTCCCAAGATCCCCGATGGAGAGAGAGTGGACTTTGATGACATCCACCGGAAGC
  GCATGGAGAAGGACCTGAATGAGTTGCAGGCGCTGATCGAGGCTCACTTTGAGAACAGGAAGAAAGAGGA
  GGAGGAGCTCGTTTCTCTCAAAGACAGGATCGAGAGACGTCGGGCAGAGCGGGCCGAGCAGCAGCGCATC
  CGGAATGAGCGGGAGAAGGAGCGGCAGAACCGCCTGGCTGAAGAGAGGGCTCGACGAGAGGAGGAGGAGA
  ACAGGAGGAAGGCTGAGGATGAGGCCCGGAAGAAGAAGGCTTTGTCCAACATGATGCATTTTGGGGGTTA
  CATCCAGAAGCAGGCCCAGACAGAGCGGAAAAGTGGGAAGAGGCAGACTGAGCGGGAAAAGAAGAAGAAG
  ATTCTGGCTGAGAGGAGGAAGGTGCTGGCCATTGACCACCTGAATGAAGATCAGCTGAGGGAGAAGGCCA
  AGGAGCTGTGGCAGAGCATCTATAACTTGGAGGCAGAGAAGTTCGACCTGCAGGAGAAGTTCAAGCAGCA
  GAAATATGAGATCAATGTTCTCCGAAACAGGATCAACGATAACCAGAAAGTCTCCAAGACCCGCGGGAAG
  GCTAAAGTCACCGGGCGCTGGAAATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276347
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001276347.1, NP_001263276.1
• RefSeq Size: 1307 bp
• RefSeq ORF: 867 bp
• Locus ID: 7139
• Cytogenetics: 1q32.1
• Protein Families: Druggable Genome
• Protein Pathways: Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM)
• Gene Summary: 'The protein encoded by this gene is the tropomyosin-binding subunit of the troponin complex, which is located on the thin filament of striated muscles and regulates muscle contraction in response to alterations in intracellular calcium ion concentration. Mutations in this gene have been associated with familial hypertrophic cardiomyopathy as well as with dilated cardiomyopathy. Transcripts for this gene undergo alternative splicing that results in many tissue-specific isoforms, however, the full-length nature of some of these variants has not yet been determined. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (7) differs in the 5' UTR and lacks an in-frame exon in the 5' coding region compared to variant 5. The resulting protein (isoform 2) is shorter but has the same N- and C-termini compared to isoform 5. Variants 2 and 7 encode the same protein.