PSG4 (NM_001276495) Human Untagged Clone

CAT#: SC333259

PSG4 (untagged) - Homo sapiens pregnancy specific beta-1-glycoprotein 4 (PSG4), transcript variant 3


  "NM_001276495" in other vectors (2)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PSG4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PSG4
Synonyms PSBG-4; PSBG-9; PSG9
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001276495, the custom clone sequence may differ by one or more nucleotides


ATGGGGCCCCTCTCAGCCCCTCCCTGCACACAGCGCATCACCTGGAAGGGGGTCCTGCTCACAGCATCAC
TTTTAAACTTCTGGAATCCGCCCACAACTGCCCAAGTCACGATTGAAGCCCAGCCACCCAAAGTTTCTGA
GGGGAAGGATGTTCTTCTACTTGTCCACAATTTGCCCCAGAATCTTGCTGGCTACATTTGGTACAAAGGG
CAAATGACATACCTCTACCATTACATTACATCATATGTAGTAGACGGTCAAAGAATTATATATGGGCCTG
CATACAGTGGAAGAGAAAGAGTATATTCCAATGCATCCCTGCTGATCCAGAATGTCACGCAGGAGGATGC
AGGATCCTACACCTTACACATCATAAAGCGACGCGATGGGACTGGAGGAGTAACTGGACATTTCACCTTC
ACCTTACACCCAAAGCTGTCCAAGCCCTACATCACAATCAACAACTTAAACCCCAGAGAGAATAAGGATG
TCTTAACCTTCACCTGTGAACCTAAGAGTAAGAACTACACCTACATTTGGTGGCTAAATGGTCAGAGCCT
CCCTGTCAGTCCCAGGGTAAAGCGACCCATTGAAAACAGGATCCTCATTCTACCCAATGTCACGAGAAAT
GAAACAGGACCTTATCAATGTGAAATACGGGACCGATATGGTGGCATCCGCAGTGACCCAGTCACCCTGA
ATGTCCTCTATGGTCCAGACCTCCCCAGCATTTACCCTTCATTCACCTATTACCGTTCAGGAGAAAACCT
CTACTTGTCCTGCTTCGCCGAGTCTAACCCACGGGCACAATATTCTTGGACAATTAATGGGAAGTTTCAG
CTATCAGGACAAAAGCTCTCTATCCCCCAAATAACTACAAAGCATAGTGGGCTCTATGCTTGCTCTGTTC
GTAACTCAGCCACTGGCAAGGAAAGCTCCAAATCCATCACAGTCAAAGTCTCTGACTGGATATTACCCTG
A


Restriction Sites SgfI-MluI     
ACCN NM_001276495
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001276495.1, NP_001263424.1
RefSeq Size 1916 bp
RefSeq ORF 981 bp
Locus ID 5672
Cytogenetics 19q13.31
Protein Families Secreted Protein
Gene Summary 'The protein encoded by this gene is a pregnancy-specific glycoprotein (PSG), one of several encoded by a cluster of similar genes on chromosome 19. This gene is a member of the carcinoembryonic antigen (CEA) gene family and may play a role in regulation of the innate immune system. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]'
Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (3) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.